Labshake search
Citations for New England Biolabs :
4801 - 4850 of 9501 citations for FabFc ZAP rat Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Genomics 2021Quote: Final libraries were prepared on beads using the NEB-Next Ultra II DNA Library Prep Kit (NEB, #E7645) as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA sequencing libraries were created using the NEBNext Ultra II Directional RNA-Seq library kit (NEB, Ipswich, MA) according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... The mutants DSR2 (N133A) and DSR2 (H171A) were constructed using the Q5 Site-directed Mutagenesis kit (NEB, E0554S) using eaither primers JG216 and JG217 ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by library preparation with NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing was performed as 100 bp single read sequencing on HiSeq2500™ (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... and domain-swapped chimeras were generated with the NEBuilder® HiFi DNA Assembly Cloning Kit (New England BioLabs). All toxins and chimeras were expressed and purified with cleavable N-terminal 6His-SUMO fusions (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: Plasmids were linearised by restriction digest and purified using Monarch PCR and DNA Clean-up Kit (NEB, USA). 3’UTRs were in vitro transcribed from 1μg of linearised plasmids using MEGAscript T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... and sequencing libraries were prepared using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs). Single-end sequencing (75 bp ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA transcripts were expressed using the NEB HiScribe T7 High Yield RNA Synthesis kit (New England Biolabs, Australia).
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR on extracted RNA was performed using the Luna One-Step RT-qPCR Kit (New England Biolabs). The samples were analyzed using a Lightcycler 480 instrument (Roche ...
-
bioRxiv - Bioengineering 2019Quote: ... Japan) were inserted downstream of SaCas9 into the vector using a NEBuilder HiFi assembly kit (New England Biolabs). For construction of plasmid used for cell sorting ...
-
bioRxiv - Microbiology 2021Quote: ... Treated RNA was used for cDNA library preparation by NEBNext Ultra II RNA library kit for Illumina (NEB).
-
bioRxiv - Molecular Biology 2020Quote: ... Exchange of V5/His to myc/His was performed using the Q5 site-directed mutagenesis kit (NEB #E0554) according to the manufacturer’s protocol resulting in pEF1-ZAP-S-myc/His and pEF1-ZAP-L-myc/His ...
-
bioRxiv - Microbiology 2019Quote: ... Table S2) were created by site-directed mutagenesis using the Q5 site-directed mutagenesis kit (New England BioLabs). For -10 region mutations ...
-
bioRxiv - Microbiology 2020Quote: ... Site-directed mutagenesis or promoter deletions were performed with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). PCR reactions were done in 50 μL containing 25 μL of Q5 Hot Start High-Fidelity 2X Master Mix ...
-
A Bidirectional Switch in the Shank3 Phosphorylation State Biases Synapses toward Up or Down ScalingbioRxiv - Neuroscience 2021Quote: ... Constructs expressing GFP-tagged or HA-tagged Shank3 phospho-mutants were generated using the Gibson Assembly kit (NEB) with the wild-type Shank3 as the template ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA libraries were prepared by removing the ribosomal RNA with NEBNext rRNA depletion kit (New England Biolabs) and NEBNext Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA sequencing libraries were generated using the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB England BioLabs). Fragmented and randomly primed 2 × 150□bp paired-end libraries were sequenced using Illumina HiSeq X10.
-
bioRxiv - Biophysics 2020Quote: ... Further truncation and point mutants of CreCat construct were prepared using the Q5 Site-Directed Mutagenesis Kit (NEB). Protein expression from E ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA libraries were prepared using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs) with following changes to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: Final libraries were prepared on beads using the NEB-Next Ultra II DNA Library Prep Kit (NEB, #E7645) as follows ...
-
bioRxiv - Biochemistry 2022Quote: ChIP-seq libraries were prepared using NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs) and NEBNext Multiplex Oligos for Illumina (New England Biolabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Stranded cDNA libraries were generated using NEBNext Ultra Direction RNA Library Prep Kit for Illumina (New England Biolabs) and indexed with NEBNext Multiplex Oligos for Illumina (Dual Index Primer Set I ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: ... Bands were extracted for subsequent amplification as above and purification using a Monarch PCR Cleanup Kit (NEB T1030L). Purified products were sequenced commercially (ACGT ...
-
bioRxiv - Neuroscience 2022Quote: ... The RNA-seq libraries were prepared using either the NEBNext Ultra II Directional RNA Library Prep Kit (NEB) and sequenced with the Novaseq 6000 platform (ILLUMINA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Poly A selection was performed using NEB Next® Ultra ™ RNA Library Prep Kit (New England Biolabs) and the sequencing libraries (250∼300 bp insert cDNA library ...
-
bioRxiv - Biophysics 2022Quote: ... PCR cleanup was carried out on each amplicon sample using the Monarch PCR cleanup kit (New England Biolabs). The amplicons were then dual-indexed for paired-end read Illumina sequencing using Nextera primers N701 and N702 for the PEL and SUP of the 5.5 h time point and N705 and N706 for the PEL and SUP of the 9.0 h time point ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA was subsequently extracted from T0 plants using Monarch DNA extraction kits (New England Biolabs, Ipswich, MA, USA) and sequence confirmed (CHU de Québec-Université Laval ...
-
bioRxiv - Genomics 2022Quote: ... ChIP libraries were prepared using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB) and NEBNext® Multiplex Oligos for Illumina® (Index Primers Set 1 ...
-
bioRxiv - Genomics 2022Quote: ... Quality of the library was analyzed by Bioanalyzer and NEBNext® Library Quant Kit for Illumina® (NEB). IS libraries were sent for sequencing to c.ATG sequencing core facility at Tübingen University and sequenced on a MiSeq instrument 2×150 bp.
-
bioRxiv - Microbiology 2022Quote: ... The online NEBasechanger (https://nebasechanger.neb.com/) was used to design primers and the Q5 Site Directed Mutagenesis Kit (NEB) was used to generate pUPRTKO-ISC6pro-AC9ΔCC-3xTy (primers P13-14) ...
-
bioRxiv - Microbiology 2022Quote: ... Any host RNA and bacterial ribosomal RNA were depleted using the NEBNext rRNA Depletion Kits (New England BioLabs). Isolated RNA was then assessed for quality using the Agilent TapeStation system ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs; version 6.0 – 2/18) using NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1 (#E7600S ...
-
bioRxiv - Genetics 2022Quote: ... The kanamycin resistance cassette-gDNA junctions were prepared for sequencing using NEB Ultra I kit (New England Biolabs). Following adapter ligation and treatment with the NEB USER Enzyme ...
-
bioRxiv - Bioengineering 2022Quote: mRNAs were transcribed from DNA templates using T7 RNA polymerase (HiScribe T7 High Yield RNA Synthesis Kit, NEB). To generate base modified mRNA variants ...
-
bioRxiv - Cancer Biology 2022Quote: ... AAK1(S-676D/E/A) and UVRAG (T-518D/E/A) using Q5-site directed mutagenesis Kit (NEB). Manufacturer’s instructions for mutagenic primer design were followed ...
-
bioRxiv - Microbiology 2022Quote: ... Resultant fragments were then gel-purified using the Monarch DNA Gel extraction kit (New England Biolabs, MA, USA) and ligated with the T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... UC Berkeley) (Chen et al 2017) were generated by site-directed mutagenesis (Q5 Site-Directed Mutagenesis Kit, NEB), using specific primers containing the sgRNA 20-mer target sequence (split in half across the two primers) ...
-
bioRxiv - Genomics 2022Quote: Libraries for sequencing were prepared using the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB E7645), as described by the manufacturer but using half volumes of all reagents and starting material ...
-
bioRxiv - Immunology 2022Quote: Plasmids containing templates for CRISPR-mediated KI were assembled using the NEBuilder HIFI assembly kit (New England Biolabs) starting from PCR amplified fragments ...
-
bioRxiv - Microbiology 2022Quote: DNA libraries were prepared with the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB, USA) according to the manufacturer’s protocol using ∼300 ng of DNA ...
-
bioRxiv - Plant Biology 2022Quote: ... The K107E and K107T mutations were generated using the Q5 Site-Directed Mutagenesis Kit (E0552S, New England Biolabs) with primers listed in Supplemental Table 3 in pENTR/D-TOPO followed by transfer to pIX-HALO ...
-
Patient-associated mutations in Drosophila Alk perturb neuronal differentiation and promote survivalbioRxiv - Cancer Biology 2022Quote: ... the AlkY1355S HDR donor construct was modified accordingly using the Q5® site-directed mutagenesis kit (NEB, #E0554S). Due to the close proximity of both codons within the sequence ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing libraries were generated using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Cell Biology 2022Quote: ... then libraries were generated using NEBNext® Ultra TM RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s recommendation ...
-
bioRxiv - Neuroscience 2021Quote: ... the cDNA libraries were generated using NEBNext Ultra RNA Library Prep Kit for Illumina (E7530S, New England Biolabs). Quality of the cDNA library was also assessed by Qubit assay for concentration ...
-
bioRxiv - Biochemistry 2021Quote: ... The E PBM C-terminal mutation (DVLL>GGGG) was performed using the Q5 site-directed mutagenesis kit (NEB). The sequences corresponding to the PDZ domains were cloned into the pCMV GFP vector using EcoRI and XhoI sites.
-
bioRxiv - Microbiology 2021Quote: ... The two amplicons were fused using a NEBuilder HiFi DNA Assembly kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription and qRT-PCR analysis was performed by Luna universal one- step qRT-PCR kit (NEB # E3005L) with primers list in Table 9.
-
ACE2-lentiviral transduction enables mouse SARS-CoV-2 infection and mapping of receptor interactionsbioRxiv - Microbiology 2021Quote: ... as was the pCDH vector before purification again with Monarch® DNA Gel Extraction Kit (New England Biolabs). The ACE2 fragment was ligated with pCDH vector using T4 DNA Ligase (New England Biolabs ...