Labshake search
Citations for New England Biolabs :
4651 - 4700 of 9501 citations for FabFc ZAP rat Antibody Internalization Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... The PCR products were purified using the Monarch DNA and PCR Cleaning kit (New England Biolabs #T1030S) and templates were digested using Dnp1 (New England Biolabs #R0176) ...
-
bioRxiv - Biochemistry 2024Quote: ... Plasmids with various mutations were generated by PCR methods using Q5® Site-Directed Mutagenesis Kit (NEB) according to the instructions and verified by Sangon ...
-
bioRxiv - Biochemistry 2024Quote: ... The transcription process was driven by T7 polymerase using HiScribe T7 High Yield RNA Synthesis Kit (NEB). After 2h transcription ...
-
bioRxiv - Microbiology 2024Quote: ... Second strand synthesis of the cDNA was carried out using the NEBNext second strand synthesis kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA isolated from cells was reverse transcribed using LunaScript® RT SuperMix Kit (New England Biolabs) to generate cDNA as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared using the NEBNext Ultra II DNA library prep kit for Illumina (New England Biolabs), profiled using the Agilent TapeStation D1000 high sensitivity ScreenTape on the Agilent 4150 TapeStation System ...
-
bioRxiv - Microbiology 2024Quote: ... inserted in plasmid vector pUC19 with the Gibson Assembly Master Mix kit (New England BioLabs, NEB # E2611S). Mutagenesis was carried out with the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... inserted in plasmid vector pUC19 with the Gibson Assembly Master Mix kit (New England BioLabs, NEB # E2611S). Mutagenesis was carried out with the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was extracted from overnight cultures using the Monarch Genomic DNA Purification Kit (New England Biolabs) and quantified using the Qubit Broad Range dsDNA kit (ThermoFisher) ...
-
bioRxiv - Microbiology 2024Quote: The in vitro transcription assay was conducted using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Sequencing libraries were generated using NEB Next® UltraTM DNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s recommendations and index codes were added ...
-
bioRxiv - Immunology 2024Quote: ... Fragmented DNA was purified using the NEB Monarch PCR&DNA Cleanup Kit (cat. T1030S, New England Biolabs). DNA libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit (cat ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was extracted from the agarose gel fragments using a gel extraction kit (New England Biolabs, T1020L) following manufacturer instructions with modification ...
-
bioRxiv - Microbiology 2024Quote: ... Mutagenesis of RBK21 constructs was carried out using the Q5 Site Directed Mutagenesis kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: RNA was extracted from samples using the Monarch® Total RNA Miniprep Kit (New England Biolabs, T2010S) and cDNA was synthesized using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2024Quote: ... and cDNA was synthesized using the ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs, E6560L). Target sequences were amplified using a modified touchdown PCR protocol (Korbie and Mattick ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library quantification was done using NEB Next® Library Quant Kit for Illumina® (New England Biolabs) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and TOP2B D64N self-trapping mutants were generated by the Q5 SDM Kit (NEB, catalog no. E0554S) following manufacturer’s instruction and mutation confirmation by sequencing ...
-
bioRxiv - Evolutionary Biology 2024Quote: Libraries were prepared using the NEBNext Ultra II DNA library Kit (New England Biolabs GmbH, Frankfurt, Germany) with purification beads and 100 ng of the fragmented/non-fragmented DNA in a volume of 25 µl were used as input according to the manufacturer’s protocol with some alterations ...
-
bioRxiv - Genomics 2024Quote: ... Ribosomal RNA was depleted from total input RNA using the NEBNext rRNA Depletion Kit (NEB cat. #E6310). First and second strand synthesis ...
-
bioRxiv - Genetics 2024Quote: ... and deletion mutant zebrafish larvae using the Monarch Total RNA Miniprep Kit (New England Biolabs (NEB, T2010S) and reverse-transcribed with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Genetics 2024Quote: ... CUT&RUN libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB; E7645L) and sequenced on NextSeq500 (paired-end ...
-
bioRxiv - Genetics 2024Quote: ... and deletion mutant zebrafish larvae using the Monarch Total RNA Miniprep Kit (New England Biolabs (NEB, T2010S) and reverse-transcribed with High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems ...
-
bioRxiv - Systems Biology 2024Quote: TT-seq libraries were built using the NEBNext Ultra II RNA Library prep kit for Illumina (NEB) according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2024Quote: Final libraries were prepared on beads using the NEBNext Ultra II DNA Library Prep Kit (NEB, #E7645) as follows ...
-
bioRxiv - Genomics 2024Quote: ... 200ng of each sample was enzymatically converted using the NEBNext® Enzymatic Methyl-seq Kit (NEB, E7120) with the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... Sequencing libraries were generated using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Immunology 2024Quote: ... Complementary deoxyribonucleic acid (cDNA) was synthesized using the ProtoScript First-Strand cDNA Synthesis kit (New England Biolabs). Real-time PCR assays were performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: ... and the vector was extracted from the gel using a Monarch DNA Gel Extraction Kit (NEB #T1020). Gibson Assembly of the three generated fragments was performed using NEBuilder HiFi DNA Assembly Master Mix (NEB #E2621) ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was synthesized from 300 ng of purified RNA using LunaScript RT SuperMix kit (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2024Quote: ... Strand-specific libraries were prepared by the NEBNext Ultra II Directional RNA Library Preparation kit (NEB, USA), as described previously (Makhnovskii et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... RNAseq libraries were constructed using a NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs). mRNA pull-down was performed using the Magnetic Isolation Module (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... coli isolates was purified using a Monarch DNA purification kit (New England Biolabs Japan Inc., Tokyo, Japan). DNA concentrations were measured using Qubit™ 4 fluorometer with Qubit™ 1× dsDNA High Sensitivity (HS ...
-
bioRxiv - Molecular Biology 2024Quote: ... POINT-seq libraries were made with the NEBNext® UltraTM II Directional RNA Library Prep Kit (NEB). POINT5-seq libraries were made with the SMARTer Stranded RNA-Seq kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2024Quote: ... and in vitro transcribed RNA was purified using the using the Monarch® RNA Cleanup Kit (NEB). Full-length 5’ RACE was performed using the GeneRacer™ with Superscript™ III RT kit (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were blocked with 5% BSA in 1X PBS for 30 minutes at room temperature followed by subsequent incubation with primary antibodies against MBP (NEB E8032L, 1:200) and RAD51 (Proteintech 14961-1-AP ...
-
bioRxiv - Biochemistry 2020Quote: ... Histone extracts were then resolved on a 15% polyacrylamide gel and Kac levels were determined with Western blot using anti-acetyllysine antibody (PTM Biolabs, Cat# PTM-101), with anti-Knbu/Kibu as the positive control using anti-butyryllysine antibody (PTM Biolabs ...
-
bioRxiv - Microbiology 2020Quote: ... it was performed following the instructions of Luna Universal qPCR Master Mix Kit M3003E (New England BioLabs, USA). Samples of eyelids ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequencing libraries were generated using a NEBNext®UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Immunoprecipitated chromatin was used for NGS library preparation (NEBNext Ultra II DNA Library Prep Kit for Illumina, NEB). Libraries were sequenced at the Max Planck Institute of Immunology and Epigenetics using HiSeq 3000 (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA of all cell lines was isolated using Monarch Total RNA miniprep kits (#T2010S, New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... NGS libraries were prepared using the NEBnext Ultra II DNA library preparation kit for Illumina (New England Biolabs) according to manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2020Quote: Poly-A RNA sequencing libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... The ClbI C-terminal GFP fusion was constructed using the Gibson Assembly kit (New England Biolabs, MA, USA). Briefly ...
-
bioRxiv - Systems Biology 2020Quote: ... Prokaryotic DNA was enriched from the total hindgut DNA extract using NEBNext Microbiome DNA Enrichment Kit (NewEngland BioLabs). Following sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... sgRNA (XXXXXXXX for KPC1 or CGGCGGCGGGATGTTCGTGC for KPC2) were synthetized in vitro using EnGen sgRNA Synthesis kit (NEB) and purified using RNA clean and concentrator (Zymo Research) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The sequencing libraries were constructed with NEB NextR UltraTM DNA Library Prep Kit for Illumina (NEB, United States) following the manufacturer’s instructions and index codes were added ...
-
bioRxiv - Cell Biology 2020Quote: ... The FER1 Ca2+-binding mutants in the C2D domain were generated by Q5 site directed mutagenesis kit (NEB) using primers 4833/4834 to change positions A1622 and A1634 to C resulting in Asp codon 542 and 545 changes to Ala.
-
bioRxiv - Cell Biology 2020Quote: ... Single or double mutations were produced with the Q5® Site-directed Mutagenesis kit (New England Biolabs, UK) using the primers in Table 1.
-
bioRxiv - Cell Biology 2020Quote: ... and pFLOE1p:FLOE1ΔDUF-GFP were obtained by modifying pFLOE1p:FLOE1-GFP using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) with primers priDSdeletion-FWD/REV ...