Labshake search
Citations for New England Biolabs :
4501 - 4550 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The two PCR products were ligated together by the Gibson assembly cloning kit (NEB)
-
bioRxiv - Biophysics 2022Quote: ... Deletion of N2B-us folding domain was accomplished by PCR and DPN1 (NEB, R0176S) reaction with subsequent KLD (NEB KLD Enzyme Mix ...
-
bioRxiv - Developmental Biology 2022Quote: ... were PCR-amplified with Q5® high-fidelity DNA polymerase (New England BioLabs, USA) and cloned in the BiFC vectors pSAT1-nEYFP-N1 (N-terminal fragment ...
-
bioRxiv - Developmental Biology 2022Quote: ... PCR was performed using Q5® high-fidelity DNA polymerase (New England BioLabs, USA), following the manufacturer’s protocol in a final volume of 12.5 μL ...
-
bioRxiv - Plant Biology 2022Quote: ... Real-time PCR was performed using Luna Universal qPCR Master Mix (New England Biolabs) and quantified on a Bio-rad CFX96 Real-time Detection System (Bio-rad) ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed with Q5 High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) using manufacturer-recommended cycling conditions with a 30 second denaturation cycle to ensure full denaturation of genomic DNA ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was carried out using Phusion DNA polymerase (New England Biolabs, Ipswich, MA, USA) and the resulting amplicons were incubated with Taq polymerase (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... All PCRs were performed using Phusion Hot Start Flex DNA Polymerase (New England Biolabs) in a 25 μL final reaction volume ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was purified using the Monarch® PCR & DNA Cleanup Kit (NEB, cat# T1030). PCR was performed using either KAPA HIFI 2X ready mix (KAPA Biosystem ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was performed using Taq DNA Polymerase with ThermoPol Buffer (New England Biolabs Ltd) with denaturation at 95° for 3 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR product was inserted into a pBlueScript vector using Gibson assembly (NEB, E2611) and transformed into NEB 5-alpha competent E ...
-
bioRxiv - Microbiology 2023Quote: ... All PCR reactions were performed using Q5 high-fidelity DNA polymerase (NEB, cat. #M0491S) according to the manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2023Quote: ... qRT-PCR was completed using the Luna Universal qPCR Master Mix (New England Biolabs). The Elongation Factor 2 homologue (GdEF-2 ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR fragments were joined together using Gibson assembly kit (NEB Cat. No. E2611L) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: SV40 LT area was amplified with PCR using Q5 High-Fidelity DNA Polymerase (NEB). Template was SV40 genome WT4 plasmid which was received as a gift from James DeCaprio ...
-
bioRxiv - Immunology 2023Quote: ... samples were amplified with NEBNext High Fidelity 2x PCR Master Mix (New England Biolabs) (Buenrostro et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... All PCR was performed using Q5 Hot Start High-Fidelity DNA Polymerase (NEB, M0493L) and the Q5 Reaction Buffer Pack (NEB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Quantitative PCR (qPCR) was performed using LUNA Universal qPCR Master Mix (New England Biolabs) on the 7500 real-time PCR machine (Applied Biosystems) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The libraries were further amplified by PCR with Pfu polymerase (NEB, Beverly, MA, USA). All libraries were sequenced with the adapter 1 primer using the Illumina HiSeq-2500 ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by cleaning up with Monarch PCR & DNA Cleanup Kit (T1030, New England Biolabs). The ligated DNA was repaired with PreCR Repair Mix (M0309 ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product obtained were purified using the Monarch DNA Gel Extraction Kit (NEB) and cloned into the pDONR207 using a BP Clonase II Kit (Thermo Fisher) ...
-
bioRxiv - Microbiology 2022Quote: ... Secondary amplification reactions were performed using NEBNext high-fidelity 2 PCR master mix (NEB) in 50 μl reactions (26 μl of 2X mix ...
-
bioRxiv - Biochemistry 2022Quote: All baculovirus constructs were cloned by PCR with Q5 DNA polymerase (New England Biolabs) and Gibson assembly with NEBuilder HiFi DNA Assembly Cloning kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... All PCR reactions were carried out with Q5 High-Fidelity DNA Polymerase (NEB #M0491). The cDNA of Pkd2 was amplified from the plasmid Pkd2-EGFP-N1 (Lab stock ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA polymerase (NEB) and digested using NotI ...
-
bioRxiv - Plant Biology 2022Quote: ... We cloned each fragment into pMiniT using the PCR Cloning Kit (New England BioLabs), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: We performed all PCR cloning with Phusion High-Fidelity DNA Polymerase (New England BioLabs). Total RNA was extracted from 3-5 mm ear primordia of the inbred line B73 using RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Physiology 2022Quote: ... PCR amplification was conducted using Phusion® DNA Polymerase (New England Biolabs, Ipswich, Massachusetts) on cDNA with AmOARβ2 isoform (Table 1) ...
-
bioRxiv - Physiology 2022Quote: ... Reverse Transcription - PCR was performed using Q5 High-Fidelity DNA Polymerase (New England BioLabs), forward primer (ATGCTCGCCAGGATGCTCAACACTACG ...
-
bioRxiv - Cancer Biology 2024Quote: ... CUT&Tag libraries were prepared with NEBNext HiFi 2x PCR Master Mix (NEB M0541S) and indexed primers (Buenrostro et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were purified and cloned using Gibson assembly master mix (New England BioLabs) into LRG3.0 ...
-
bioRxiv - Immunology 2023Quote: ... and amplified using NEBNext® High-Fidelity 2x PCR Master Mix (NEB, Cat. #M0541s) for 9 cycles ...
-
bioRxiv - Biochemistry 2024Quote: All PCR was performed with Q5 High-Fidelity DNA Polymerase kit (New England Biolabs) according to manufacturer’s protocols ...
-
bioRxiv - Biophysics 2024Quote: Cloning procedures involving PCR were performed using Q5 High-fidelity polymerase (New England Biolabs) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Cellular genes were amplified by PCR (Q5 High-Fidelity DNA Polymerase, New England Biolabs) after DNA extraction (Quick-DNA Miniprep Kit ...
-
bioRxiv - Microbiology 2024Quote: ... gladioli strain FDAARGOS_389 strain using Q5 High-Fidelity DNA polymerase PCR (New England Biolabs) following 20 µl final volume and reaction components mentioned in the manufacturer’s protocol (https://www.neb.com/en-us/protocols/2013/12/13/pcr-using-q5-high-fidelity-dna-polymerase-m0491) ...
-
bioRxiv - Systems Biology 2024Quote: ... the enzyme’s activity was immediately neutralised using the Monarch PCR & DNA Cleanup Kit (NEB). Subsequently ...
-
bioRxiv - Immunology 2024Quote: ... sample amplification was performed using a library PCR using Q5 Master Mix (M0544L, NEB), 1 µL i7 Index primer (Sigma-Aldrich®) ...
-
bioRxiv - Molecular Biology 2024Quote: qRT-PCR was conducted by using Luna Universal qPCR Master Mix (New Englad Biolabs) and a CFX ConnectTM Real-Time System (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2024Quote: ... and assembled by two-step PCR (supplementary methods) using Q5 polymerase (New England Biolabs). First ...
-
bioRxiv - Molecular Biology 2024Quote: PCR was performed using Q5 High Fidelity 2X Master Mix (New England Biolabs, M0492) with the following temperature and times.
-
bioRxiv - Microbiology 2024Quote: ... The PCR amplifications were performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs) with supplementation with High GC-enhancer to the reaction following the manufacturer’s instructions and primers synthesized by Eurofins Genomics ...
-
bioRxiv - Genomics 2024Quote: The ligation product was purified using a Monarch PCR & DNA Cleanup Kit (NEB #T1030) following the manufacturer’s recommended protocol ...
-
bioRxiv - Developmental Biology 2024Quote: All PCR reactions were done in 50𝜇l volume using Q5 high fidelity polymerase (NEB) following NEB Q5 high fidelity PCR protocol ...
-
bioRxiv - Genomics 2024Quote: ... Two 50 μl PCR reactions were performed per sample with Q5 Polymerase (NEB M0492S) with real-time tracking using SYBR green dye with the following cycling parameters 98°C - 3 min ...
-
bioRxiv - Genomics 2024Quote: ... Four 50 μl PCR reactions were performed per sample with Q5 Polymerase (NEB M0492S) with the following cycling parameters ...
-
bioRxiv - Bioengineering 2024Quote: Constructs were cloned by PCR methods using Q5 High-Fidelity Polymerase (New England Biolabs) and fragments were assembled by Gibson assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR reactions were performed using Q5 High-Fidelity DNA polymerase (New England Biolabs, USA) and purified using DNA Clean and Concentrator 5 kit (Zymo) ...
-
bioRxiv - Bioengineering 2024Quote: ... 500 µL PCR reagents containing 1.67X Q5® High-Fidelity Master Mix (NEB, M0515), 0.625 mg/mL BSA ...
-
bioRxiv - Genetics 2023Quote: ... and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs). After mutagenesis ...