Labshake search
Citations for New England Biolabs :
4451 - 4500 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed by Q5 High-Fidelity DNA Polymerase (New England Biolabs, Inc. USA) with the listed primers (Table 2 ...
-
bioRxiv - Genetics 2020Quote: ... DNA integration in the correct location was confirmed by PCR (Taq DNA Polymerase NEB M0267L ...
-
bioRxiv - Genomics 2021Quote: Blunt-end PCR amplicons underwent A-tailing using HotStarTaq DNA Polymerase (New England Biolabs). The PCR products from the nested 3’/5’RACE were cleaned-up using QIAquick PCR purification Kit and then mixed with 5 µl 10x DNA polymerase reaction buffer ...
-
bioRxiv - Genomics 2021Quote: ... Samples were PCR amplified using the Phusion High-Fidelity DNA Polymerase (New England Biolabs) and an annealing temperature of 68 °C over 15 amplification cycles (OG218/OG219) ...
-
bioRxiv - Cell Biology 2020Quote: ... All PCR reactions were performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs). MISSION shRNA constructs were obtained from Sigma in pLKO.1-puro vectors ...
-
bioRxiv - Cell Biology 2019Quote: ... Full-length oligonucleotides (74 nt) were amplified by PCR using Phusion HS Flex (NEB) and size-selected using a 2% agarose gel (Primers ...
-
bioRxiv - Genomics 2019Quote: ... 4uL of the SMD PCR product was treated with KLD mix (New England Biolabs) and transformed into DH5a E ...
-
bioRxiv - Cell Biology 2019Quote: ... The PfGRP170 transit peptide PCR was digested with Nhe1 and AatII (New England Biolabs) and the GFP PCR was digested with AatII and BglII (New England Biolabs) ...
-
bioRxiv - Microbiology 2019Quote: ... Colonies were screened for gene insert using PCR with Taq polymerase (New England Biolabs) and primers shown in Table S3 ...
-
bioRxiv - Genomics 2021Quote: ... genomic PCR was performed using Q5® High-Fidelity DNA polymerase (New England BioLabs) according to the manufacturer’s instruction ...
-
bioRxiv - Genetics 2021Quote: ... the PCR products were digested with 20 U of HinfI (New England Biolabs, USA) for 3 hr at 37°C and separated on a 6% polyacrylamide gel ...
-
bioRxiv - Genetics 2020Quote: ... and PCR was performed using Phusion High-fidelity DNA Polymerase (NEB Cat no. M0530S). PCR products of junctions containing MMBIR events were sequenced by Sanger sequencing to confirm the presence of the MMBIR insertion within the rearranged allele ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or NEBNext Q5 HotStart HiFi PCR Master Mix (New England BioLabs, Ipswich, MA, USA) for eight to 14 cycles ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNAs were subjected to end-point PCR using OneTaq® 2X Master Mix (NEB) or quantitative PCR (qPCR ...
-
bioRxiv - Biochemistry 2020Quote: ... Deletion mutants of hnRNP L and SETD2 were constructed by PCR (Phusion polymerase, NEB) using full-length hnRNP L and SETD2 ...
-
bioRxiv - Neuroscience 2020Quote: ... SaCas9 was amplified by PCR with Q5 High-Fidelity DNA Polymerase (New England Biolabs) using primers CATCGACTACGAGACACGGG and TTGTGCACGCCTCTTCTCTT ...
-
bioRxiv - Cell Biology 2021Quote: ... all sgRNAs were amplified using Phusion Flash High-Fidelity PCR Master Mix (NEB, M0531L) with the primers ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCRs were performed using either: (i) the Q5 High-Fidelity 2x Master Mix (NEB), followed by DpnI (NEB ...
-
bioRxiv - Genetics 2019Quote: ... These were used in a PCR reaction with Q5 Hi-Fidelity polymerase (NEB, USA) in combination with the pLuc-GAL5.1 reporter construct previously described 8 as template to produce pLuc-GALΔEGR ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR product DNA was digested with DraIII restriction enzyme (New England Biolabs, R3510S). Wild-type allele generated 180 bp and mutant allele generated 50 and 130 bp bands.
-
bioRxiv - Cancer Biology 2021Quote: ... and the PCR product was cloned into the XbaI/XboI cut (New England Biolabs) and dephosphorylated (Fast AP ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PCR reactions were conducted using Taq DNA Polymerase (New England BioLabs, Ipswich, MA, USA) with the primers listed in supplementary table S1 ...
-
bioRxiv - Biophysics 2020Quote: ... The resulting PCR product was subsequently inserted using Gibson Assembly Master Mix (NEB, E2611L) into the lentiviral vector CD813A (System Biosciences ...
-
bioRxiv - Genetics 2021Quote: ... All PCR reactions were performed using Q5 High-Fidelity DNA polymerase (New England Biolabs).
-
bioRxiv - Evolutionary Biology 2021Quote: ... The IGQ1 locus was amplified via PCR and incubated with SspI (New England Biolabs) overnight ...
-
bioRxiv - Immunology 2020Quote: ... The PCR assays using NEB enzyme Q5® Hot Start High-Fidelity (NEB, M0491) with the following thermocycling conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR was performed with Hot Start Taq 2X Master Mix (New England Biolabs Inc) in a 20 μL reaction mixture containing 1.5 mM of MgCl2 ...
-
bioRxiv - Microbiology 2020Quote: ... The insert PCR product and pREF100 were double digested with NotI and PstI (NEB). Digested PCR products were ligated into the pREF100 shuttle vector downstream of an anhydrous tetracycline (aTc ...
-
bioRxiv - Microbiology 2020Quote: DNA fragments for cloning were PCR-amplified with Phusion DNA polymerase (New England Biolabs) from stationary phase cultures of wild type (WT ...
-
bioRxiv - Biophysics 2021Quote: ... Mutants were generated by mutagenesis PCR using the Q5 Site-Directed Mutagenesis Kit (NEB), according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... was carried out by end-point PCR with Taq DNA polymerase (New England Biolabs) and 2 μl of cDNA ...
-
bioRxiv - Immunology 2021Quote: ... Two rounds of PCR were performed using Q5 High-Fidelity 2X Master Mix (NEB). For the first round of PCR ...
-
bioRxiv - Molecular Biology 2020Quote: ... The library was amplified using NEBNext High-Fidelity 2X PCR Master Mix (NEB; M0541S) and cleaned using SPRI-beads with left-side size selection protocol ...
-
bioRxiv - Immunology 2020Quote: ... High-fidelity PCR amplification of coding sequences using Q5 DNA polymerase (NEB, Ipswich, MA) was performed for regions encoding the N-terminal domain (NTD ...
-
bioRxiv - Immunology 2021Quote: ... Second PCR reactions were carried out using Phusion® High-Fidelity DNA Polymerase (NEB) with the following cycling conditions ...
-
bioRxiv - Microbiology 2021Quote: ... and Bp1026b_II2523 were PCR amplified from Bp82 genomic DNA using Phusion DNA polymerase (NEB) or Kapa HiFi polymerase (KapaBiosystems ...
-
bioRxiv - Immunology 2021Quote: ... The PCR product and pM965 were digested with PstI-HF and EcoRV-HF (NEB) before kit purification (SV Gel and PCR Clean up System ...
-
bioRxiv - Immunology 2020Quote: Phage DNA was PCR-amplified with Q5 High-Fidelity DNA polymerase (New England Biolabs) in two rounds to produce Illumina libraries containing adaptor sequences and barcodes for multiplexing ...
-
bioRxiv - Microbiology 2021Quote: ... Each PCR included 12.5 μL Q5 High Fidelity 2x Master Mix (New England Biolabs), 3.6 μL of either pool 1 or pool 2 10μM primer master mix (final concentration of each primer was ~10-11pM) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was amplified in two rounds of PCR using Q5 high-fidelity polymerase (NEB). Adapters necessary for sequencing on the Illumina platform were introduced with the KAPA HyperPrep kit (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR products were circularized using the commercially available KLD Enzyme Mix (New England Biolabs). The resulting plasmids were confirmed by sequencing.
-
bioRxiv - Genetics 2019Quote: ... was used as template for a PCR reaction with Q5 polymerase (New England Biolabs) and primers Cdc3AspBfw and Cdc3AspBextend1 according to the polymerase manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The sgRNA-containing region was PCR-amplified with NEBNext Ultra II Q5 MasterMix (NEB), acrylamide gel-purified ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR was performed with Phusion® high-fidelity DNA polymerase (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 10 μl of bound DNA was used for library amplification using PCR (NEB, E7370S). Routinely 8-10 PCR cycles were used to generate enough amount of library DNA for sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were generated using Q5 Hot Start High-fidelity system (New England Biolabs). Plasmids encoding IPTG-inducible sdsR or spf (Spot 42 ...
-
bioRxiv - Neuroscience 2022Quote: ... The 4mt-GCamP6f PCR product was phosphorylated using T4 Polynucleotide Kinase (New England Biolabs) and digested using AscI ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR fragments were amplified using Q5 High-Fidelity 2x Master Mix (New England Biolabs). The primers (IDT ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR was carried out with Q5 High-Fidelity 2X Master Mix (New England BioLabs) using the conditions recommended by the manufacturer for 35 cycles ...
-
bioRxiv - Biochemistry 2022Quote: ... A standard PCR protocol with Phusion® High Fidelity DNA polymerase (New England Biolabs) and primer-specific annealing temperatures was used for the DNA amplification ...