Labshake search
Citations for New England Biolabs :
401 - 450 of 4152 citations for Pops Hrms Hch Clean Up Spike 13C6 99% 50X Stock 1 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... A stock solution of these oligos (1μl of a 10μM) was 5’-end-labeled using T4PNK (NEB®) and 5μl of ATP ...
-
bioRxiv - Cell Biology 2023Quote: ... Free nucleotides were purchased as 100mM stocks of dATP or dUTP as sodium salts in ultrapure water (NEB) and stored at -20°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 mM Tris-Cl pH 7.4, 12 mM MgCl2, 1% NP-40, 0.5 mM DTT, 0.1 mg/ml cycloheximide, 80 U/ml NEB murine RNase inhibitor). Beads were transferred to a fresh tube and immunoprecipitated RNA extracted by incubating beads in buffer RLT (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA fragments were purified from the reaction using a Zymo DNA Clean & Concentrator-5 kit (in-house) and amplified with NEBNext High Fidelity PCR Mix (NEB). Library quality was assessed using a Fragment Analyzer system (Agilent) ...
-
bioRxiv - Cell Biology 2023Quote: ... They were then transferred to a clean tube for elution by boiling in 1X SDS Blue Loading Buffer (New England Biolabs) at 85°C for 10 minutes ...
-
bioRxiv - Immunology 2022Quote: ... and we digested up to 3 μg of DNA with 3 μl of EcoRI-HF restriction enzyme (New England Biolabs) per 50 μl.
-
bioRxiv - Molecular Biology 2019Quote: ... and set up in an overnight in vitro transcription reaction (HiScribe T7 Quick High Yield RNA Synthesis kit, New England BioLabs). The resulting RNA was purified using Silane beads (Life Technologies ...
-
bioRxiv - Plant Biology 2019Quote: ... RT-PCR reaction volumes were set up to 12.5 μL containing Luna Universal qPCR Master Mix (New England Biolabs Inc.), 2 μl of a 1:10 dilution of cDNA reaction ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Transformation reactions were set up using 5ul of ligation reaction and 50ul chemically competent E.coli cells (New England Biolabs # C3040I) and performed as per manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... whereas adapters 2 and 3 have a closed loop hairpin structure that is opened up after the ligation step by the cleavage of the uracil with the USER enzyme mix (New England Biolabs). It is suggested that closed loops adapters reduce adapter dimers during ligation (New England Biolabs) ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: ... Transcription reactions were set up with RNA NTPs (5 mM each ATP, CTP, UTP, 9 mM GTP) (NEB, Ipswitch, MA), 0.004 U/µL Thermostable Inorganic Pyrophosphatase (NEB ...
-
bioRxiv - Genomics 2022Quote: ... Proximity ligation was set up at room temperature with the addition of the following reagents: 100 μL of 10X T4 DNA ligase buffer (NEB), 10 μL of 10 mg/mL BSA and 50 μL of T4 Ligase (NEB M0202L ...
-
bioRxiv - Cancer Biology 2021Quote: ... For cloning the oligo pool into the appropriate lentiviral backbone the following reaction was set up: 5 μl 10x Cutsmart buffer (NEB), 1 mM DTT (final) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resulting amplicons from each replicate/strain were cleaned up using the Monarch PCR & DNA Cleanup kit (New England Biolabs). Next ...
-
bioRxiv - Developmental Biology 2022Quote: ... at 4°C for up to one month until used for purification of total RNA with the Monarch Total RNA Miniprep Kit (NEB). Five larvae were pooled for each RNA purification and homogenized in DNA/RNA protection buffer with a glass homogenizer prior to proteinase K digestion ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... up to 400 ng of genomic DNA was digested with the SbfI-HF and MspI restriction enzymes (New England BioLabs) for 3h at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... The ligation reaction was then set up by combining the cDNA and adapter mixture with 1X T4 DNA Ligase Buffer (NEB), 500 mM Betaine ...
-
bioRxiv - Genetics 2023Quote: ... The final cleaned-up Hi-C library was used as input material for Illumina sequencing library prep kit (NEB, E7805) with 6-8 cycles of PCR amplification using KAPA-HiFi (Kapa Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... Up to 1ug of RNA is then converted into cDNA using the NEB LunaScript® RT Supermix Kit (NEB #E3010) followed by qPCR using the NEB Luna Universal qPCR Master Mix (NEB #M3003) ...
-
bioRxiv - Systems Biology 2024Quote: ... The samples then underwent two separate digestion reactions (with up to 4 µg of genomic DNA) using NlaIII and MseI enzymes (NEB) at 37°C overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... Stored lenses were kept at either 4°C for up to one week or -20°C for up to one month before purification of total RNA with the Monarch Total RNA Miniprep Kit (NEB). We used approximately 30 lenses at 10 dpf ...
-
bioRxiv - Developmental Biology 2024Quote: ... bulk-extracted genomic DNA from these strains was used to set up PCR reactions for each primer set using Quick Load Taq 2X Master Mix (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids containing either rpsL-cat or the inducible promoter tetO1 [18] flanked by regions homologous to the DNA up- and downstream of the ggt-promoter were constructed using a commercially available Gibson Assembly Cloning Kit (NEB). Homologous regions were amplified from the genomic DNA of strain PMSS1 using primer pairs FlgK fwd/FlgK rev (rpsL/tetO1 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl BSA (20 mg/ml) (New England Biolabs Inc., Ipswich, MA, USA), 10 μl Brilliant III Ultra-Fast SYBR® Green Low ROX qPCR Master Mix (Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... and 1 μl T4 RNA ligase 2 (truncated K227Q, NEB, 200,000 units/ml) and incubated at 16°C for 14 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... The clarified lysate is mixed with 1 mL of amylose resin (E8021S, NEB) pre-equilibrated with lysis buffer and incubated in the cold room using an end-over-end rotor for 2 hours ...
-
bioRxiv - Genomics 2023Quote: ... Nuclei were then digested with DpnII (1:50) (NEB, 50 000 U/ml) for 4h at 37°C under agitation ...
-
bioRxiv - Cell Biology 2022Quote: ... mixed with 10 μl of lysis buffer (10 mM Tris-HCl [pH 8.8], 1 mM EDTA, 25 mM NaCl, 1% SDS and 8U/ml Proteinase K, NEB) for 3 min at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cells were washed in 800 µL of 1.2X CutSmart solution (from 10X CutSmart stock (NEB, #B7204S, Ispwich, MA)) and pelleted at 900 g for 2 min ...
-
bioRxiv - Genomics 2020Quote: ... Transformation efficiencies of all strains were monitored and normalised using a stock solution of pLITMUS28 (New England Biolabs, USA). In addition ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression of all SurA and SurA-OmpA proteins was carried out using chemically competent home-made stocks of E.coli strain BL21(DE3) originally sourced commercially (NEB). Both proteins were over-produced separately in 1 L of cultures as described previously [42] ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression of all soluble proteins used chemically competent home-made stocks of E.coli strain BL21(DE3) originally sourced commercially (NEB).
-
bioRxiv - Synthetic Biology 2022Quote: ... These were phosphorylated (2 μL 100 μM oligo stock, 2 μL 10X T4 DNA ligase buffer (New England Biolabs), 1 μL T4 PNK (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... Reverse transcription product was purified using a DNA Clean and Concentrator-5 and used as the template for PCR amplification using i5 and i7 dual indexing primers (NEB #E7600S).
-
bioRxiv - Evolutionary Biology 2020Quote: ... The single-stranded labeled probes were finally cleaned up using the Monarch PCR & DNA cleanup kit (New England Biolabs®, T1030) following the oligonucleotide cleanup protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... 100 ng of gDNA were used to set up a PCR using Phusion® High-Fidelity DNA Polymerase (New England BioLabs). The PCR product was separated in a 1% agarose gel by electrophoresis ...
-
bioRxiv - Molecular Biology 2021Quote: ... Pre-miRNAs were purified on denaturant polyacrylamide gel and long pri-miR-K10/12 derived transcripts (up to ∼3 kb) were salt purified using Monarch® PCR and DNA cleanup kit (New England BioLabs). After acidic phenol extraction and ethanol precipitation ...
-
bioRxiv - Genomics 2019Quote: ... three sets of ligation reactions were set up by incubating 600 ng of purified digested DNA with 2 µl of high-concentration T4 DNA ligase (NEB, M0202T) overnight at 4C in a volume of 400 µl ...
-
bioRxiv - Microbiology 2021Quote: ... and Down primer sets were used in individual PCR reactions alongside the common primers 5’ GGTAACTGTCAGACCAAGTTTACTC 3’ (Up) or 5’ GAGTAAACTTG-GTCTGACAGTTACC 3’ (Down) using Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, M0494). Primers were designed as described in https://github.com/a5russell/Defective_Library_Mendes_Russell ...
-
bioRxiv - Microbiology 2022Quote: ... LAMP reactions were set up using the NEB WarmStart® LAMP Kit (DNA & RNA) (E1700S, New England Biolabs, Ipswich, Massachusetts, USA) and using the two designed primer sets ...
-
bioRxiv - Cell Biology 2023Quote: ... The digested fragments were gel-purified and then cleaned up using a GenepHlow™ Gel/PCR Kit before ligation into the appropriate vector using T4 ligase (New England Biolabs). The ligated plasmids were transformed into DH5α ...
-
bioRxiv - Plant Biology 2023Quote: ... RNA extraction was done with TriZol from the 12 fractions collected and then samples were cleaned up using the Monarch® RNA Cleanup Kit (50 μg) from New England Biolabs (NEB). Optical densities (OD260 ...
-
bioRxiv - Genomics 2024Quote: ... IVT reactions were set up in 30 μl total volume with the HiScribe T7 High Yield RNA Synthesis Kit (NEB E2040S) with 2 μl of each NTP ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 mM sodium ascorbate before collecting them by scraping in 1 mL of the same solution with Murine RNase Inhibitor (1:1000, NEB). Cells were collected in a microcentrifuge tube ...
-
bioRxiv - Genetics 2021Quote: ... Electroporated bacteria were immediately split into eight 1 mL aliquots of SOC (NEB, B9020S) and recovered for 1 h at 37 °C then independently expanded in 20 mL of LB supplemented with 100 μg/mL of carbenicillin (EMD ...
-
bioRxiv - Microbiology 2019Quote: ... 1 mM calcium chloride and 200 unit/ml final concentrations of micrococcal nuclease (NEB). Cell lysates were incubated at 25 ℃ for 15 minutes before adding 3 mM final concentration of EGTA was added.
-
bioRxiv - Genomics 2021Quote: ... The template was destroyed by adding 1 μL 20,000 U/mL DpnI (NEB, R0176S) to the mix and incubating at 37 °C for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 μl T4 RNA ligase 2 (truncated K227Q, NEB, M0242, 200,000 units/ml) and incubated at 16°C for 14 h ...
-
bioRxiv - Bioengineering 2019Quote: ... the culture media mix was TSB with 1 mg/mL BSA (New England Biolabs) and 50 μM calcein ...
-
bioRxiv - Biochemistry 2021Quote: ... and 0.02% NP-40) including 1 μL of PstI (NEB, at 100,000 U/mL), 2 mM ATP (Sigma-Aldrich) ...