Labshake search
Citations for New England Biolabs :
401 - 450 of 4933 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... supplemented with 20% PEG8000 (NEB). Ligated miRNA-adapter fragments were gel-purified and eluted in 0.3 mM NaCl ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 U BsaI-HFv2 (NEB), and 400 U of Salt-T4 DNA Ligase (NEB) ...
-
bioRxiv - Systems Biology 2024Quote: ... 20 units NheI (#R0131S; NEB), 20 units AvrII ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Genomics 2021Quote: ... 15 μL of MboI restriction enzyme (New England Biolabs R0147) was used for digesting chromatin from 15 million MEFs ...
-
bioRxiv - Biochemistry 2022Quote: ... Then complexes were bound to 15 µl amylose agarose (NEB) by rotating the tube at 4 °C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... from 4 to 15 hours at 37 °C. For Circle-Seq of the CRISPR treatments and controls (Fig. 5) exonuclease T (New England Biolabs; 20 units per μg of DNA) was then added ...
-
bioRxiv - Microbiology 2020Quote: ... to ensure sterility before incubation for 45 minutes with 24 μl microccocal nuclease (NEB) and 15 μl DNaseI (Thermo Fisher ...
-
bioRxiv - Genomics 2023Quote: ... M.EcoGII (24 µl; 600 units at 25 units/µl; New England Biolabs M0603B-HC1) or 24 µl water was added to each of five aliquots ...
-
bioRxiv - Biophysics 2024Quote: ... 100 ng or less template DNA and 24 μL Taq DNA polymerase (NEB M0273L). Purify and concentrate the PCR DNA product by ethanol precipitation ...
-
bioRxiv - Molecular Biology 2020Quote: Individual LAMP assays were assembled in a total volume of 25 μl of 1X Isothermal buffer (NEB; 20 mM Tris-HCl, 10 mM (NH4)2SO4 ...
-
bioRxiv - Synthetic Biology 2021Quote: SynHox assemblon BACs were verified by digesting a ∼250-500ng purified by alkaline lysis (72) from small scale (5-10 mL) saturated bacterial culture with PvuI-HF (New England Biolabs R3150S). Digestion reactions were carried out at 37°C for 3-24 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... the used RNA was radioactively labelled on the 5’-end with [γ-32P]ATP (10 mCi/ml, Hartmann Analytic) and T4 PNK (NEB), following purification via PAGE ...
-
bioRxiv - Plant Biology 2020Quote: ... The suitability of the selected restriction enzyme pair was confirmed by digesting 400 ng of genomic DNA using 5 Units of each restriction enzyme and NEB CutSmart™ buffer (10×) (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Molecular Biology 2021Quote: ... and sequencing adaptors (5 μl) from the Ligation Sequencing Kit (ONT, #LSK109) and Quick T4 DNA Ligase (10 μl) (NEB, M2200S) were added to the cleaved and dA-tailed gDNA sample ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units) of λ PP (New England Biolabs, Ipswich, MA). Untreated lysates received 1-2 μl of water in place of λ PP ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101, 2/5 Nuclease-free water, 1/10 CutSmart Buffer 10X (NEB)] ...
-
bioRxiv - Genomics 2022Quote: ... 10 U of the enzyme was used in the 50 μl-reaction containing 5 μl of rCutSmart Buffer (10X, NEB # B6004S) for 30 min-incubation at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... PCR amplification was carried out by addition of 5 µL 10 µM Nextera index mix(Vazyme, #TD203) and 25 µL Q5 High-Fidelity 2X master mix (NEB, #M0492S) to the 20 µL sample ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 μL of PCR product was added to a 10 μL reaction containing 0.2 μL DraI (New England BioLabs, MA, USA) and 1 μL rCutSmart™ Buffer (New England BioLabs ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng of RCA amplicons were treated with T7 endonuclease 5 μL of 10× reaction buffer and 1 μL of T7 endonuclease I (New England Biolabs, M0302S) in a 50 μL reaction volume ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The mixture was then returned to ice for 5 minutes before 180 μL of NEB® 10-beta/Stable Outgrowth Medium (B9035, NEB) was added ...
-
bioRxiv - Genomics 2023Quote: ... The pellet was resuspended in 90 µL of freshly prepared Micro-C “Master Mix 1” (10 μl 10x T4 DNA Ligase Buffer, 75 μl ddH2O, 5 μl T4 PNK (NEB #M0201L)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 20 mM MgCl2) prior to addition of 20 units (2 µl) NruI (New England Biolabs). The restriction digests were carried out at 37 ◦C for 2 hours ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 µl Taq 5× Master Mix (New England Biolabs) and 18 µl Milli-Q water (18.2 MΩ cm) ...
-
bioRxiv - Developmental Biology 2024Quote: ... then capped with m7G (5’) ppp (5’) G (NEB) and tailed with a poly(A ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 4: 4°C hold) using NEB Next High-Fidelity master mix (NEB) in 25 µl reaction volume using RAD-Marker for/ RAD-Marker rev primers (25 nM each ...
-
bioRxiv - Cell Biology 2020Quote: ... Oct-4 (NEB, D7O5Z), Sox2 (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 ml ScaI (BioLabs), followed by 3 h of incubation with a fresh portion ...
-
bioRxiv - Genetics 2020Quote: For Southern blot analysis 150 ng of mouse DNA was digested with 10 units of BamHI-HF (NEB, Figure 2 and 5), NdeI (NEB ...
-
bioRxiv - Plant Biology 2020Quote: ... The suitability of the selected restriction enzyme pair was confirmed by digesting 400 ng of genomic DNA using 5 Units of each restriction enzyme and NEB CutSmart™ buffer (10×) (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genetics 2023Quote: ... One microliter of T-tailed DNA adaptors diluted to 1.5 µM in water was added to 5 µl of amplicons diluted to 1/10 in water and 5 µl of 2X Blunt/TA Ligase Master Mix (New England Biolabs, Herts, UK) and incubated 30 min at 25°C for ligation ...
-
bioRxiv - Microbiology 2020Quote: ... The ligation reactions were conducted using 15 pmol of RtcB (NEB), 1x RtcB buffer (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... and amplified for 15 PCR cycles using Q5 polymerase (NEB, M0491). PCR products were run on a gel ...
-
bioRxiv - Molecular Biology 2023Quote: ... Viral cDNA was amplified for 15 cycles with Phusion polymerase (NEB) using a primer complementary to the adaptor (TGGATTGATATGTAATACGACTCACTATAGG ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 µg of pUPRT plasmid was linearised with AgeI-HF (NEB) (GRA59 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1mM DTT) before adding 15 µl 1 mg/ml Streptavidin (NEB) before immediate wash with DLB-C-T buffer (DLB supplemented with 1 mg/ml α-casein ...
-
bioRxiv - Genomics 2024Quote: ... 15 μl of 400 U/μl T4 DNA ligase (NEB, M0202L), followed by 4h incubation at RT with gentle rocking ...
-
bioRxiv - Cell Biology 2024Quote: ... for 15 minutes at 37C and then BsmBI- V2 (NEB #R0739S) was added for a second digest at 55°C for 20 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... plus 15 μL Prot K (T2010, New England Biolabs, MA, USA) was added to the tissue homogenate and incubated at 55°C for 5 min ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)A RNA (GpppA) (NEB, # S1406S) and G(5′)ppp(5′)G RNA (GpppG ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl T4 PNK (NEB M0201, 5 U/μl), and incubated for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... 5′ de-capping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S), (3 ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)G RNA (GpppG) (NEB, # S1407S) are from New England Biolabs (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’-cap was removed using RNA 5′ pyrophosphohydrolase (Rpph, NEB) followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... and m7G(5′)ppp(5′)G capped (New England Biolabs) RP51A pre-mRNA substrates were made by in vitro transcription of a linear DNA template with T7 RNA polymerase (Agilent or purified in the laboratory) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 20 units PNK enzyme (NEB, M0201S), 30 μCi γ-32P-ATP ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 U DpnI (New England Biolabs), and completed the volume to 60 μl with PCR grade water ...