Labshake search
Citations for New England Biolabs :
301 - 350 of 4933 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Genetics 2021Quote: ... Nuclei were pelleted at 500 rcf at 4°C for 5 minutes and resuspended in 90 uL 1X Cutsmart Buffer (NEB B7204S). 10 uL of 10U/uL AluI restriction enzyme (NEB R0137S ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Plant Biology 2024Quote: RNA was isolated from leaves 4 and 5 using Trizol and cDNA was synthesized using MuMLV reverse transcriptase (New England Biolabs, Inc.) primed with random hexamers ...
-
bioRxiv - Biophysics 2020Quote: ... and loaded denatured (70 °C, 10 minutes) samples alongside an RNA ladder (2-4 μL, ssRNA ladder, N0362S, NEB). The resulting gels were stained with ethidium bromide for 30 minutes (0.5 μg/mL ddH20 ...
-
bioRxiv - Cell Biology 2023Quote: ... nuclei were collected by centrifugation at 800g for 10 minutes at 4°C and resuspended in 1.2 X of NEB buffer 2.1 (New England Biolabs, B7202). 1 x 107 nuclei were then solubilized with 0.3% SDS for one hour at 37°C followed by adding 1.8% of TritonX-100 and incubating one hour at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... 37.5 μl of 0.4 mM biotin-14-dATP and 10 μl of 5 U/ μl Klenow (NEB, M0210L) were added and mixed by pipetting ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was denatured again and pyrophosphates were removed from the 5’-end by 10 U RppH (M0356S, NEB) in 1× NEB buffer 2 (10 mM Tris-HCl pH 7.9 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μl of 10 mM MnCl2 and 1 μl (400 units) of λPP (New England Biolabs, Ipswich, MA). Untreated lysates received 1 μl of H2O in place of λPP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and decapped with 10 U of T4 PNK +/− 40 nmol of ATP and 5 U of RppH (NEB). After each step ...
-
bioRxiv - Genetics 2024Quote: ... Each 10 μL qPCR reaction contained 5 μL of NEBNext Q5 Hotstart HiFi PCR master mix (NEB # M0543L), FwdInnerSeq and RevInnerSeq at 500 nM each (final concentration ...
-
bioRxiv - Genomics 2020Quote: ... and 0.4 μl of 20 mg/ml BSA with 1 μl (10 U/μl) of T4 endonuclease V (NEB, T4-PDG) and 1 μl (10 U/μl ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL P7 primer (10 μM) (5ʹ-CAAGCAGAAGACGGCATACGAG AT[i7] GTCTCGTGGGCTCGG-3ʹ; IDT) and 20 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541). Amplification was performed using the following program ...
-
bioRxiv - Genomics 2021Quote: ... and supernatant was transferred to a new tube and added to 2 μL 10% SDS and 2 μL 20 mg/mL proteinase K (New England Biolabs P8107). Samples were incubated overnight at 65°C to reverse crosslinks ...
-
bioRxiv - Genomics 2022Quote: ... Primers which had then annealed in adjacent positions were ligated through the addition of 10 U (20 μL) Taq ligase (NEB M0208L) and incubation at 55°C for 1 hour then 75°C for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plugs were washed in 20 ml of Milli-Q water for 30 minutes and then 10 ml of 1x rCutSmart buffer (New England Biolabs, B6004S) for 1 hour followed by a further hour in 5 ml of 1x rCutSmart buffer ...
-
bioRxiv - Microbiology 2023Quote: ... The sonicated DNA was end-repaired for 30 minutes at 20°C in 200 μl final volume containing 1x end-repair buffer and 10 μl of end-repair mix (NEB, E6050L). The reaction was cleaned in 2x AmpureXP Beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μL template cDNA/DNA was used in a 20 μL reaction containing 10 μL Luna® Universal qPCR Master Mix (New England Biolabs). The qPCR program was ...
-
bioRxiv - Microbiology 2024Quote: nfsA and nfsB mutants were constructed by gene inactivation using the pKNOCK suicide plasmid (22) The DNA fragments were amplified with Phusion high-fidelity DNA polymerase (NEB, UK) from E ...
-
bioRxiv - Bioengineering 2023Quote: ... then the mixture was cooled to room temperature (∼22 °C) prior to immediate transformation into NEB Stable chemically competent bacteria (NEB #C3040H).
-
bioRxiv - Microbiology 2024Quote: ... barcode junctions for each hypomorph strain were amplified from 40ng genomic DNA with 22 cycles using Q5 High Fidelity 2X master mix (NEB M0492L). Each PCR reaction was done in 40μL containing 4μL genomic DNA ...
-
bioRxiv - Microbiology 2021Quote: ... 15 μL of PCR product were mixed with 5 μL of a 5X Exo-SAP solution (15% Shrimp Alkaline Phosphatase – 1000U/ ml – NEB, 10% Exonuclease I – 20000 U/ ml – NEB, 45% glycerol 80% and 30% dH2O). and incubated for 30 min at 37°C and for 15 min at 80°C ...
-
bioRxiv - Cell Biology 2023Quote: ... After 24 h cell lysates were treated with PNGase-F (NEB, P0704L) or water by following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 mM RVC (NEB), 0.1 mg/mL salmon sperm DNA (Thermo Fisher)] with agitation at 40 °C overnight ...
-
bioRxiv - Genetics 2022Quote: ... 20 μL Phusion (NEB) reactions were set up according to manufacturer’s protocol with primers MK193 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’ adapters with 4 terminal randomized nucleotides at the 3’ end was added using T4 RNA ligase (New England Biolabs, cat# M0204S). Ligation was carried out for 1 hour at 25°C with 20% PEG8000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ end of the digested RNA is then labelled with 10 U T4 PNK (New England Biolabs M0201) and 10 µCi [γ-32P]ATP (Perkin Elmer BLU002Z250UC ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in 18.5 μL T4 DNA Ligase Reaction Buffer with 5 μL of 10 μM annealed Broken end linker and 1.5 μL T4 DNA Ligase (#M0202S, New England Biolabs). The reaction was incubated 18-20 h at 16°C with constant mixing ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The total volume reaction was 25 μl with the following composition: 5 μL 10× buffer at 1.0 mM (New England BioLabs), 0.1 mM each dNTP ...
-
bioRxiv - Genomics 2021Quote: ... Ligation was done overnight at 16°C also rotating at 900rpm for 10 seconds every 5 minutes by adding 120μl of 10X ligation buffer (NEB), 664μl water ...
-
bioRxiv - Biochemistry 2021Quote: ... The mixture was incubated at room temperature for 10 min followed by transformation into 5-alpha competent cells (NEB). The E ...
-
bioRxiv - Developmental Biology 2022Quote: ... Ligation was done overnight at 16°C also rotating at 900rpm for 10 seconds every 5 minutes by adding 120µl of 10X ligation buffer (NEB), 664µl water ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNase-treated RNA (10 µg) was fragmented by using 5 units of ShortCut RNase III (New England Biolabs, M0245) for 5 min at 37°C and the reaction was stopped by adding 10 µL nuclease free water ...
-
bioRxiv - Molecular Biology 2023Quote: ... then ligated to a custom 5′ adapter (10 μM oligocap) by T4 RNA Ligase I (M0437, New England Biolabs) with 1 μl RNaseOUT for 16 hours at 16°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... A circular form of the 3I_RAN FLEXI synthetic oligonucleotide control was generated by incubating the 5’ phosphorylated-3I_RAN FLEXI oligonucleotide (500 ng) with T4 RNA Ligase I (10 U; New England Biolabs) for 2 h at 25°C and 2 min at 95°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 10 µg of pUC19 was cleaved with EcoRI and labeled at the 5′ ends using T4 polynucleotide kinase (NEB) with [γ-32P]-ATP or at the 3′ ends using Klenow (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... Radiolabeling of 50 pmol of RNA substrate was performed in 20 μl of reaction mix using 10 U of T4 PNK (New England Biolabs, cat. M0201) and 3μL of ?32P-ATP (Perkin Elmer ...
-
bioRxiv - Microbiology 2023Quote: ... at a final volume of 20 μL with 10 μL of Luna® Universal qPCR Master Mix (New England Biolabs, Frankfurt, Germany). Each primer was added at a final concentration of 300 nM ...
-
bioRxiv - Developmental Biology 2023Quote: ... The PCR product was injected into N2 worms at 10-20 ng/μl with 50 ng/μl pRF4 and 50 ng/μl DNA ladder (NEB, Ipswich, MA). The pRF4 plasmid produces a dominant roller phenotype ...
-
bioRxiv - Molecular Biology 2023Quote: ... Adapter ligation was performed at 20°C for 10 min, with Adapter Mix (AMX, ONT) and Blunt/TA Ligase Master Mix (New England BioLabs, cat# M0367). After a final 1X clean-up and washing of the beads with Adapter Binding Buffer (ABB ...
-
bioRxiv - Genomics 2023Quote: ... restriction enzyme (10 units of HpyCH4IV [NEB] for PCR7 and PCR31, and 20 units of TaqI-v2 [NEB] for PCR11 and PCR12), 1 μL of 10X CutSmart buffer (NEB) ...
-
Pre-implantation genome-wide methylation enables environmental adaptation in a social meso-carnivorebioRxiv - Genomics 2024Quote: Samples of ∼200 ng genomic DNA were digested with 20 units of MspI (C↓CGG) and 10 units of AluI (AG↓CT) (New England Biolabs, United Kingdom) at 37°C overnight (∼16 hours) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ triphosphates on the synthesis products were converted into 5’ monophosphates: samples were treated with recombinant shrimp alkaline phosphatase (NEB) (10 µl reaction in 1× NEB buffer 2.1, 37°C 30 min, 65°C 5 min), these reactions were made up to 15 µl including 0.5 µl 10× NEB 2.1 ...
-
bioRxiv - Biochemistry 2020Quote: ... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
bioRxiv - Genomics 2021Quote: ... and 15 units of Phi29 polymerase (New England Biolabs). We used a PCR machine (SimpliAmp ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15 U T4 RNA Ligase High Concentration (M0437, NEB)) were added as well as 10 μl 50% PEG8000 and reaction was mixed by pipetting up- and down until beads are resuspended ...
-
bioRxiv - Genomics 2023Quote: ... 15 units of RNase H1 (NEB, cat. no. #M0297) or 1 μg/μL RNase A (Life Technologies ...
-
bioRxiv - Genomics 2023Quote: ... and 15 units of Phi29 polymerase (New England Biolabs). We used a PCR machine (SimpliAmp ...
-
bioRxiv - Genomics 2024Quote: ... After adding 15 μl of Proteinase K (NEB, P8107S), the solution was incubated at 55°C overnight ...