Labshake search
Citations for New England Biolabs :
401 - 450 of 3716 citations for 3 hydroxy 20 oxopregn 5 en 21 yl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then ligated to the 3’ end of the cDNA by using Thermostable 5’ App DNA/RNA Ligase (New England Biolabs) for 2 h at 65°C ...
-
bioRxiv - Biochemistry 2024Quote: ... and ligated to a preadenylated oligonucleotide linker (NI-816: 5’-/5Phos/NNNNNTAGACAGATCGGAAGAGCACACGTCTGAA/3ddC/-3’) using T4 RNA Ligase 2 truncated KQ (NEB). Unligated linker was depleted by treatment with yeast 5’-deadenylase (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... and nCoV_IP4-14084 Probe(+)TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as PFU equivalents (eqPFU ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ pir-2 flank::PtrpC::nat::3’ pir-2 flank assembly was constructed using NEBuilder Assembly Kit (New England Biolabs). Each assembly fragment was either synthesized (T4 Oligo ...
-
bioRxiv - Biochemistry 2024Quote: ... cDNA was PCR amplified using the primers directed against 5′ and 3′ RNA cassettes and NEB Q5 HotStart polymerase (NEB). To introduce unique barcodes ...
-
bioRxiv - Biochemistry 2024Quote: ... either at the 5’ or 3’ of the trimerization domain and then inserted into a pET29b+ vector using PaqCI (NEB). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... and 20 μl of HindIII (NEB, 20 units/μl) were added to the nuclei pellet and digested for 1.5 h at 37 °C in thermomixer (Eppendorf ...
-
bioRxiv - Systems Biology 2022Quote: ... 5’-AAAC(N)19-20-3’) by combining 1 μl of each 100 μM oligonucleotide with 1 μl of 10× T4 ligation buffer (NEB cat. no. B0202S), 6.5 μl of water ...
-
bioRxiv - Biochemistry 2020Quote: ... chromatin and chromatin bound fractions were released from magnetic beads using binding buffer containing 5 mM CaCl2 plus an excess (2000 units/ 20 mL reaction) of micrococcal nuclease (MNase; NEB, M0247S) Beads were incubated for 5 minutes at 37 °C with shaking (1250 rpm) ...
-
bioRxiv - Microbiology 2023Quote: NINL (1-702) containing an amino-terminal HaloTag was expressed in BL-21[DE3] cells (New England Biolabs), which were then grown until OD 0.4-0.6 and induced with 0.1 mM IPTG for 16 hr at 16°C ...
-
bioRxiv - Genomics 2023Quote: ... L1 - Adaptor.L8 with Adaptor.S (21)) was annealed with the DNA fragments by T4 DNA ligase (New England Biolabs) incubating overnight at 16 °C ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Cell Biology 2022Quote: ... The mixture was incubated for 3 days at 37 °C in the dark for conjugation and purified for 3 rounds using Monarch® PCR & DNA Cleanup Kit (5 μg) (Cat# T1030S, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were pelleted at 1,000 x g for 5 min at 4°C then resuspended in 450 μl of 1X NEBuffer 3 (NEB, cat. # B7003S). Primary restriction enzyme digestion of intact nuclei was carried out overnight at 37°C using 50,000 U of DpnII (NEB ...
-
bioRxiv - Genomics 2022Quote: ... an adenylated 5’ end and a dideoxycytosine blocked 3’end – was ligated to size-selected small RNAs using T4 Rnl2tr K227Q (NEB, M0351L) for 16 hours at 25°C ...
-
bioRxiv - Genomics 2020Quote: ... The PCR product and pGAD-C1 vector were digested with ClaI (5’-ATCGAT-3’, New England BioLabs Inc., MA, CA#R0197S) and SalI (5’-GTCGAC-3’ ...
-
bioRxiv - Genomics 2021Quote: Capping with 3’ Desthiobiotin GTP (DTB-GTP) was performed in 50 µl total volume with 5 µL Vaccinia capping enzyme (NEB M02080) and 0.5 mM DTB-GTP (NEB N0761) ...
-
bioRxiv - Cell Biology 2021Quote: ... The library was PCR amplified using universal primers that annealed to the common flanking sequence and appended homologous sequences at 5’ and 3’ ends of the PCR product to enable Gibson assembly (New England Biolabs E2611) into pZLCv2_puro_1KF ...
-
bioRxiv - Microbiology 2020Quote: ... and internal transcribed spacer 4 (ITS4) (5′ TCCTCCGCTTATTGATATGC 3′) primers,27 along with the Phusion High Fidelity DNA polymerase (New England Biolabs, Ipswich). Touch-down method of PCR was used for increased specificity of primer amplification in a Surecycler 8800 (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Microbiology 2020Quote: ... The 3’ends of end-repaired DNA were extended with an A-overhang with 3’ to 5’ exonuclease-deficient Klenow DNA polymerase (NEB, M0212L). The resulting fragments were ligated to Nextflex 6bp adaptors (Bio Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA template for the assay was generated by annealing a primer (5′-CCCAGTCACGACGTTGTAAAACG-3′) to M13mp18 single-stranded DNA (New England Biolabs, N4040S). The assay was initiated by incubation of 1nM of DNA template with 1 mM ATP ...
-
bioRxiv - Molecular Biology 2020Quote: ... where 200pmol 5’-adenylated,3-dideoxyC DNA adapters (Table 1) were ligated with 400U truncated T4 RNA ligase 2 (NEB M0242) in 1X ATP-free T4 RNA ligase buffer [50mM Tris pH 7.5 ...
-
bioRxiv - Microbiology 2022Quote: ... 8 candidate Envs containing variations of signature mutations were synthesized by Synbio Technologies and were cloned into the SHIV.3C backbone using the BsmBI restriction sites at the 5’ and 3’ end of the CH505 Env cassette and then ligated together using T4 ligase (New England Biolabs #M0202S). 8 plasmids encoding full-length SHIV.C.CH505 combination clones were used to transfect 293T cells as described above ...
-
bioRxiv - Molecular Biology 2023Quote: ... barcoded 5’ -pre-adenylated linkers were added to the 3’ ends of footprints using T4 Rnl2(tr) K227Q (New England Biolabs, M0351S), and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre ...
-
bioRxiv - Molecular Biology 2023Quote: ... Small RNAs were treated with 5′ RNA polyphosphatase (Epicenter RP8092H) and ligated to 3′ pre-adenylated adapters with Truncated T4 RNA ligase (NEB M0373L). Small RNAs were then hybridized to the reverse transcription primer ...
-
bioRxiv - Plant Biology 2023Quote: ... and MpERF20 cds in situ R (5’ GTACAAGAAAGCTGGGTCGGCGCGCCttacatgagtgggggaactaaaagaagagt-3’) and seamlessly cloned using NEBuilder HiFi DNA Assembly (New England Biolabs, #E5520) into pENTR-D linearized with NotI/AscI ...
-
bioRxiv - Microbiology 2023Quote: ... and vcircRNA873/1151 (oligonucleotide probe 5’- CAGGACAACAGGGCCAGCAAGGTGGCGGACATCACAACCA-3’ against the junction) were performed using γ-32P-dATP-end labeled (PNK kinase, NEB) probes ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction underwent ethanol precipitation as described above and the precipitated DNA was suspended in 32 μl Elution buffer and used in a 50 μl A-tailing reaction using Klenow (3’→5’ exo-) (NEB, M0212), incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: Internally fluorescein-labelled RNA was produced by ligation of in vitro transcribed 5′ acceptor RNA fragment with chemically produced 3′ donor RNA containing internal fluorescein dT modification and 5′ monophosphate essential for ligase activity using T4 Ligase 2 (NEB #M0239S). Additionally ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3.3 kb DNA sequence upstream of each respective gene was amplified using PCR and cloned into the vector containing the sequence gfp::rab-7::rab-7 3’UTR amplified from plasmid rgef-1p::gfp::rab-7::rab-7 3’UTR using PCR and primers 5’-atgagtaaaggagaagaacttttca-3’ and 3’-aagcttatcgataccgtcgac-5’ were used to generate tissue-specific gfp::rab-7::rab-7 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Genetics 2023Quote: ... 600 ng linearized plasmid backbone and 48 ng of digested library (molar ratio of 1:3) were ligated with 5 μL (2000 U) of T4 DNA ligase (NEB M0202S) in a 100 μL reaction ...
-
bioRxiv - Developmental Biology 2022Quote: ... the cells were washed 3 times with PBS and permeabilized 5 min on ice with permeabilize sol (1xPBS, 1%RNAse inhibitor Ribovanadylcomplex (RVC, NEB,#S1402S), 0,5 % Triton X-100 (Sigma ...
-
bioRxiv - Genomics 2022Quote: ... blunt DNA fragments on the beads were adenine-tailed by adding 7μl of Klenow 3’→5’ exo-polymerase 5U/μl (New England Biolabs cat. #M0212L), 2.3μl of dATP 10mM and 5 μl NEB2 of 10x NEBuffer 2 and incubating the mixture 30 minutes at 37ºC and a further 10 minutes at 65ºC to inactivate the enzyme.
-
bioRxiv - Microbiology 2022Quote: ... The resulting double-stranded oligos had 5’ extensions that were complementary to the non-palindromic 3’ overhangs generated by BsaI-HFv2 (NEB, R3733) digestion of pJJW101 ...
-
bioRxiv - Microbiology 2024Quote: ... The mixture was incubated for 3 days at 37C in the dark for conjugation and purified for 3 rounds using Monarch PCR & DNA Cleanup Kit (5 µg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Small RNAs were treated with 5’ RNA polyphosphatase (Epicenter RP8092H) and ligated to 3’ pre-adenylated adapters with Truncated T4 RNA ligase (NEB M0373L). Small RNAs were then hybridized to the reverse transcription primer ...
-
bioRxiv - Genomics 2024Quote: ... The aliquots were then divided into 3 digest reactions of 5 M cells and digested with the NlaIII restriction enzyme (NEB, R0125L). After subsequent proximity ligation and DNA extraction ...
-
bioRxiv - Cancer Biology 2024Quote: ... ChIP–seq libraries were prepared from 3–5 ng of ChIPed DNA using NEBNext Ultra II DNA Library Prep Kit (NEB, E7645S), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl proteinase K (20 mg/ml) (New England Biolabs) and 25 μl 10sSodium dodecyl sulphate (SDS ...
-
bioRxiv - Microbiology 2024Quote: ... Decapping of the 5’ DTB-GTP cap was performed to leave the 5’ monophosphate for ligation by adding 20 μl of capped RNA to 2.2 μl of 10X ThermoPol buffer (NEB product number B9004) and 2 μl RppH (NEB product number M0356S) ...
-
bioRxiv - Molecular Biology 2022Quote: ... A-tailed fragments were ligated to 50 nL of 5 mM T7 promoter containing adapters(21) with cell barcodes and UMI with 150 nL ligation mix (25 nL T4 DNA ligase (400.000U, NEB), 3.5 nL MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... which was subsequently cloned into linearized pUHE-21 (106) using NEBuilder HiFi DNA Assembly Cloning Kit (New England BioLabs). Construct was verified by Sanger DNA sequencing with primers 146 and 156.
-
bioRxiv - Molecular Biology 2024Quote: ... T1413I).21 Mutant sequences were generated by PCR and introduced using NEBuilder HiFi DNA Assembly Master Mix (NEB E2621L). After obtaining the pETDuet-1::dddA11tox-dddIA plasmid ...
-
bioRxiv - Biophysics 2024Quote: NINL and BicD2 constructs containing N-terminal HaloTags were expressed and purified as described.16,24 Constructs were transformed into BL-21[DE3] cells (New England Biolabs) cells and cell were grown at 37°C with shaking until they reached to an optical density at 600 nm of 0.4-0.6 ...
-
bioRxiv - Biochemistry 2020Quote: ... The doubly-digested vectors were assembled with a single fragment containing the ORF containing 5’ and 3’ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2020Quote: ... reverse primer S-D-Bact-0785-b-A-18 (5’ TAC NVG GGT ATC TAA TCC 3’) and a high fidelity Taq polymerase master mix (Q5, New England Biolabs, Massachusetts, USA). Primer sequences were based on Klindworth et al.24 ...