Labshake search
Citations for New England Biolabs :
451 - 500 of 3716 citations for 3 hydroxy 20 oxopregn 5 en 21 yl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: The purified PCR reaction was then A-tailed with 15 units Klenow Fragment (3’ – 5’ exo-) (New England BioLabs; Ipswitch, MA, USA) in 1X NEB Buffer 2 (New England BioLabs ...
-
bioRxiv - Cell Biology 2020Quote: ... of full-length SEC16A were generated by mutating 10 nucleotides in the silencer-select Sec16A siRNA (5’-CGGAGCUUCUGUUACGAGATT-3’, siRNA id: s19236, Thermo-Fischer Scientific) binding site using Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) following manufacturer’s instructions.
-
bioRxiv - Biochemistry 2020Quote: ... or a control motif (5’-GGGACCCTGGGAGGG-3’) were prepared by viral replication using a helper phage M13K07 (New England BioLabs, Cat#N0315S). E.coli XL1-Blue cells were transformed with pBluescript SK(- ...
-
bioRxiv - Microbiology 2020Quote: ... the algR gene was amplified from gDNA using primers (algR-pUC-5, algR-pUC-3) and subcloned into pUC19 (New England Biolabs, Ipswich, MA). Site-directed mutagenesis was performed by amplification of pUC19::algR with primers (algR-D54E-Fw ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were then 3’dephosphorylated by denaturing at 65°C for 5 min and incubating with T4 PNK (NEB, catalog no. M0201S) in a 10 μL reaction (7 μL precipitated RNA ...
-
bioRxiv - Microbiology 2024Quote: ... A repair template plasmid carrying the ∼1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard HYGR cassette inserted between the two flanks ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA was A-tailed with Fermentas Klenow 3′ to 5′ exonuclease (Cat# EP0421) and ligated with adaptor oligonucleotides (NEB NEXT adaptor oligos) using Mighty Mix Ligase (Cat# TAK6023) ...
-
bioRxiv - Genetics 2022Quote: ... the homology 5’arm and 3’arm was amplified and linked to the pBS backbone with Gibson Assembly Kit (NEB, cat. no.E2611L) as ‘pBS-CG32814-arm’ ...
-
bioRxiv - Plant Biology 2022Quote: ... The doubly digested vectors were assembled with a single fragment containing the ORF containing 5′ and 3′ adapters for Gibson assembly using 2x NEB Hifi Mastermix (NEB, Ipswich, MA). The finished constructs were transformed into BL21 Rosetta (DE3 ...
-
bioRxiv - Microbiology 2022Quote: ... A repair template plasmid carrying the ~1 kb of sequence immediately 5’ and 3’ to this gRNA sequence from the H99 genome was constructed using HiFi DNA Master Mix (NEB Cat#E2621) with a standard NATR cassette inserted between the two flanks ...
-
bioRxiv - Molecular Biology 2024Quote: ... a 5’ phosphorylated 3’ end adapter featuring 4 randomized nucleotides at the 5’ terminus and a 3’ blocking group (3C Spacer; 3SpC3, IDT) underwent adenylation using Mth RNA ligase (New England Biolabs, cat# M2611A). Adapters were subsequently ligated to deacylated and demethylated RNA templates using a truncated KQ T4 RNA ligase 2 (New England Biolabs ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5’ adapters with 4 terminal randomized nucleotides at the 3’ end was added using T4 RNA ligase (New England Biolabs, cat# M0204S). Ligation was carried out for 1 hour at 25°C with 20% PEG8000 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 21-base pair (bp) barcodes (post-culture) were amplified by PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs). Primers used are listed in Supplemental Table 11 ...
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid hcm1 sequence was amplified by PCR for 21 cycles with vector specific primers using Phusion High-Fidelity DNA polymerase (New England Biolabs). Products were extracted from a 1% agarose gel using the QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Genomics 2022Quote: A second-generation lentiviral transfer plasmid encoding expression of EF1ɑ promoter - CAR-P2A-mCherry (21) was digested with XbaI & MluI (New England Biolabs) to drop out the CAR-P2A-mCherry transgene ...
-
bioRxiv - Biochemistry 2024Quote: ... were inserted between the codons of residues N196 and K197 in the γ subunit of pHC95_γΔN4C25 (published previously [21]) by amplifying the plasmid with primers (Integrated DNA Technologies): and Phusion DNA polymerase (New England Biolabs (NEB)) ...
-
bioRxiv - Cell Biology 2024Quote: ... Mutant hcm1 sequence was amplified by PCR (21 cycles) using plasmid specific primers and Phusion High-Fidelity DNA polymerase (New England Biolabs). DNA fragments were purified from a 1% agarose gel using a QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Plant Biology 2021Quote: ... a non-adenylated 3’ adapter was ordered for chemical synthesis from IDT™ and adenylated with the 5’ DNA Adenylation Kit (New England Biolabs® Inc.) (see Supplemental Table 4 for primers and adapters used) ...
-
bioRxiv - Neuroscience 2020Quote: ... 20 mM RVC (NEB), 0.1 mg/mL salmon sperm DNA (Thermo Fisher)] with agitation at 40 °C overnight ...
-
bioRxiv - Genetics 2022Quote: ... 20 μL Phusion (NEB) reactions were set up according to manufacturer’s protocol with primers MK193 ...
-
bioRxiv - Biochemistry 2020Quote: ... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragments containing 21 base pair overhangs homologous to the vector backbone were generated by PCR using Phusion High-Fidelity DNA polymerase (NEB, M0530), purified ...
-
bioRxiv - Neuroscience 2020Quote: ... with PAM underlined: GCAACTGGTACAGATGACACAGG) targeting exon 21 of the Brp gene was generated using the HiScribe T7 Kit (New England Biolabs #E2040S) by incubating for 6 hours at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... or 300 ng (day 21) of total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England BioLabs E7490L). Libraries were prepared using the NEBNext Ultra II RNA Library Prep kit with Sample Purification Beads (E7775S ...
-
bioRxiv - Bioengineering 2024Quote: cDNA of each library was generated using oAS345 (Supplemtary Note 21) and LunaScript Primer-Free RT Master Mix Kit (NEB E3025S).
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of total RNA were ligated to the pre-annealed custom RT adaptors (21) using concentrated T4 DNA Ligase (NEB-M0202T). Ligated RNA was reverse transcribed using Maxima H Minus RT (Thermo Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... were inserted between the codons of residues N196 and K197 in the γ subunit of pHC95_γΔN4C25 (published previously [21]) by amplifying the plasmid with primers (Integrated DNA Technologies): and Phusion DNA polymerase (New England Biolabs (NEB)) ...
-
bioRxiv - Genomics 2022Quote: ... and for the synthesis of the second strand of cDNA was used the Klenow fragment 3’-5’ exo (New England Biolabs Inc., Ipswich, MA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: DpnII digest:20 ug genomic DNA + 20 uL DpnII buffer (New England Biolabs) + 4 uL DpnII 9New England Biolabs ...
-
bioRxiv - Genomics 2021Quote: ... 20% PEG8000 and 20 U T4 RNA Ligase 1 (New England Biolabs, M0204) at 16°C for 12 hours.
-
bioRxiv - Microbiology 2023Quote: ... and treated with 20 µL DNase I (New England Biolabs, 20 U/mL) for 1 hr at 28 °C ...
-
bioRxiv - Bioengineering 2022Quote: ... 20 U of Exonuclease I (1µL of 20 U/µL) (NEB; catalog # M0293L), and 0.5 µL of 10X rCutSmart Buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid expressing EBFP2-14-3-3 theta was created using HiFi Cloning (NEB) of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665) ...
-
bioRxiv - Immunology 2021Quote: ... 3’ loxP site and 3’ arm of homology) was linearized with NotI (NEB) and recombineered into RP24-227B3 BAC clone that was transformed into SW102 strain by electrophoration (186 ohms ...
-
bioRxiv - Microbiology 2024Quote: ... and different 5′ cap structures of the viral genome were obtained by the addition of m7G(5′)ppp(5′)A cap analog or G(5′)ppp(5′)A cap analog (NEB). 2μg of transcript RNA was subsequently transfected into host cells seeded in a six-well plate with Lipofectamine MessengerMAX transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... and m7G(5′)ppp(5′)A (NEB, #S1405S) also referred throughout the manuscript as N7-meGpppG and N7-meGpppA for consistency ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µL RNase H (5 U/µL, NEB), 2.5 µL RNase III (1 U/µL ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were brought up to 50μl and subsequently digested with 1μl of Nuclease P1 in 50mM sodium acetate buffer (New England Biolabs, M0660) for 2h at 45°C ...
-
bioRxiv - Microbiology 2022Quote: ... RNAs were precipitated in cold ethanol and 0.3 M of sodium acetate and dephosphorylated using Calf-intestinal alkaline phosphatase (New England Biolabs), according to manufacturer protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... and digested in a 20 µL reaction with 20 units of BamHI-HF (NEB) and 20 units of HindIII-HF (NEB ...
-
bioRxiv - Genomics 2024Quote: ... we performed 21 total linear cycles (19 cycles with Bsu polymerase and 2 cycles with Bst polymerase, New England Biolabs, Ipswitch, MA) and 17 total exponential amplification cycles using Herculase II Fusion DNA polymerase (Agilent Technologies ...
-
bioRxiv - Genetics 2021Quote: ... 20 units NheI (#R0131S; NEB), 20 units AvrII ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 20 units of TdT (NEB) and the provided TdT buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... Exonuclease I (20 U, NEB) were added to digest cDNA and oligonucleotide sequences ...
-
bioRxiv - Microbiology 2020Quote: ... Exonuclease I (20 U, NEB) was added to each PCR reaction and incubated at 37 °C for 15 minutes ...
-
bioRxiv - Developmental Biology 2023Quote: ... supplemented with 20% PEG8000 (NEB). Ligated miRNA-adapter fragments were gel-purified and eluted in 0.3 mM NaCl ...