Labshake search
Citations for New England Biolabs :
401 - 450 of 10000+ citations for 20 Hydroxyecdysone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: Thermocycler was used to denature and anneal 5 µl of PCR product as recommended by manufacturer (EnGen™ Mutation Detection Kit, NEB, E3321S). Thermocycler was adjusted for heteroduplex formation as following ...
-
bioRxiv - Genetics 2022Quote: ... the homology 5’arm and 3’arm was amplified and linked to the pBS backbone with Gibson Assembly Kit (NEB, cat. no.E2611L) as ‘pBS-CG32814-arm’ ...
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Unligated linkers were depleted by using 5 U per sample of 5’ deadenylase (NEB, #M0331S) and RecJ exonuclease (Biosearch Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L). Post-transcriptional polyadenylation was performed using E ...
-
bioRxiv - Genomics 2020Quote: ... Adapter ligation (AMX) was performed at RT (20 °C) for 20 minutes using NEB Quick T4 DNA Ligase (New England Biolabs, MA, USA). The reaction mixture was purified using 0.6X AmPure beads (Beckmann Coulter ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 0.5 µl of 1 mg mL−1 purified bovine serum albumin (1:20 dilution in dH2O of BSA, Molecular Biology Grade 20 mg ml−1, NEB cat. B9000), 0.25 µl of T4 DNA ligase at 400 U µL−1 (NEB cat ...
-
bioRxiv - Genomics 2021Quote: ... Adapter ligation (AMX) was performed at RT (20 °C) for 20 min using NEB Quick T4 DNA ligase (New England Biolabs, MA, USA). The reaction mixture was purified using 0.6X AmPure beads (Beckman Coulter ...
-
bioRxiv - Bioengineering 2022Quote: All Golden Gate Assembly reactions started with 1 µg of the constructed plasmid (pIS001, pIS002, or pIS003) and BsaI-HFv2 (20 or 60 U from 20 U/µL) (NEB; catalog # R3733L), 400 U of T4 DNA ligase (1 µL of 400 U/µL ...
-
bioRxiv - Molecular Biology 2020Quote: 1000 ng per sample was then processed using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (cat # E7760L; New England Biolabs, Ipswich, USA; protocol v. v3.1_5/20) including PolyA selection ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 units of Vaccinia capping enzyme (New England Biolabs), 100 units of 2’-O-Me-transferase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 units of murine RNase inhibitor (New England Biolabs), 12.5 mM DTT ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 20 U/μL Exonuclease I (NEB, Cat #M0293), 20 U/μL HinfI enzyme (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... A 20 μL reaction containing 1X VCE buffer (NEB), 10 μL of the eluted RNA ...
-
bioRxiv - Microbiology 2020Quote: ... 20 s annealing at the temperature given by NEB TM calculator (https://tmcalculator.neb.com) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 8 μL of BSA (20 mg/mL B9000S, NEB,) and 100 Units of ligase (M0202M ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 20 units of DpnI (NEB; for removing template plasmid), and 5μl of 10x-CutSmart buffer (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... 40 nM Reb1 and 20 Units of BamHI (NEB) was added ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was digested with 20 U of MseI (NEB) at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: Assemble 20 μL IVT reaction (New England BioLabs – E2050S) (8 μL of template in NFW ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 units of Vaccinia capping enzyme (New England Biolabs), 100 units of 2′-O-Me-transferase (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... 20 μl Phusion DNA polymerase (2 U/μl, NEB), 160 μl Taq DNA ligase (40 U/μl ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 μl of 10 mM dNTPs (New England Biolabs), 10 μl of Sulfolobus DNA polymerase IV (New England Biolabs ...
-
bioRxiv - Plant Biology 2019Quote: ... and 20 units of M-MuLV (New England Biolabs) for 1 h at 42°C and then for 15 min at 70°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and SpeI-HF (20 units; R3133S, New England Biolabs) in 10X CutSmart buffer (5 μL ...
-
bioRxiv - Genetics 2020Quote: ... 20 μls (200 units) of proteinase K (NEB, USA) and 20 μl of 20% SDS was added and the tube was incubated at 65 °C for o/n ...
-
bioRxiv - Neuroscience 2022Quote: ... 15-20 µL of amylose beads (New England Biolabs) were mixed with (MBP)2-WRC (bait ...
-
bioRxiv - Molecular Biology 2022Quote: ... then incubated with 20 U of DNaseI (NEB # M0303S) at 37°C for 15 min ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... 20 µl phi29 DNA Polymerase (10 U/µl, NEB) and incubated for 12 h at 30 °C ...
-
bioRxiv - Biophysics 2023Quote: ... and 20 U CpG methyltransferase M.SssI (New England BioLabs) (20 μL total volume ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 µL of 50% (v/v) amylose resin (NEB) was added to each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... 20 μL of 500 mM PNPP (New England Biolabs) was then added to the 190 μL protein mixture (per well ...
-
bioRxiv - Genomics 2023Quote: ... 1% (v/v) BSA (20 mg/ml, NEB, B9000S) + 5μL of hash oligo (10 uM ...
-
bioRxiv - Biochemistry 2022Quote: ... 20 μM (nt) ΦX174 Virion DNA (New England Biolabs) was incubated in 1X RecA buffer (25 mM Tris-acetate (80% cation ...
-
bioRxiv - Cancer Biology 2023Quote: ... then 1 μl 20 U/μl SfiI (NEB R0123S) was added and incubation continued overnight at 50°C ...
-
bioRxiv - Microbiology 2023Quote: ... and RNase A (New England Biolabs, 20 U/mL) [70] ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% (v/v) BSA (20 mg/ml, NEB, B9000S) + 5μL of hash oligo (10 uM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 µl of 20 mg/ml RNase A (NEB) was added ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 mM vanadyl ribonuclease complex (New England Biolabs, S1402S), and 20 μM β-mercaptoethanol ...
-
bioRxiv - Systems Biology 2023Quote: ... Note that 20 ng of a pUC19 (NEB #09052008) carrier plasmid was included in all transfection conditions with 25 ng of each reporter plasmid for a more even uptake of the latter.
-
bioRxiv - Cell Biology 2024Quote: ... and 20 U/μL terminal transferase (NEB, no. M0315S). After incubation at 37°C for 30 min and termination at 70°C for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... samples were pooled by plate and ExonucleaseI (NEB) digestion was performed ...
-
bioRxiv - Plant Biology 2021Quote: ... a non-adenylated 3’ adapter was ordered for chemical synthesis from IDT™ and adenylated with the 5’ DNA Adenylation Kit (New England Biolabs® Inc.) (see Supplemental Table 4 for primers and adapters used) ...
-
bioRxiv - Physiology 2022Quote: ... in zebrafish f5 proximal promoter sequences (Fig. 4E, Supplemental Table 5) (28) was conducted using a Q5 site-directed mutagenesis kit (NEB, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... of which 5 μl was processed with the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina® (New England Biolabs) with previously published modifications to the manufacturers protocol 37 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were resuspended in spheroblast buffer (1.2 M sorbitol, 0.1 M potassium phosphate, 20 mM vanadyl ribonuclease complex [NEB S1402S], 20 μM beta-mercaptoethanol) and digested with 0.002% 100T zymolyase (US Biological Z1005 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fixed cells were resuspended in 1 mL spheroplast buffer (1.2 M sorbitol, 0.1 M potassium phosphate, 20 mM vanadyl ribonuclease complex [NEB S1402S], 20 µM beta-mercaptoethanol), and 1.2–5 µL 100T zymolyase (US Biological Z1005 ...
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence in between the ORFs NCAS0D00680 and NCAS0D00690 was amplified (primers: Ncas_Int618_For 5′-GTTCGCCGGCCTTCCCGCGCTATGAAATTA and Ncas_Int618_Rev 5′-ATCAGGCGCCGAGCATAACCGCTCAAATGC) and inserted between the NaeI and KasI (NEB) restriction sites ...