Labshake search
Citations for New England Biolabs :
501 - 550 of 10000+ citations for 20 Hydroxyecdysone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 5 µL of GC Enhancer (NEB), 5 µL of 5X buffer ...
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Genomics 2023Quote: ... or 5 U MboI (NEB R0147S) in 15 μl rCS buffer for 1 h at 37°C and analysed in a 1.2% agarose gel containing ethidium bromide ...
-
bioRxiv - Immunology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2024Quote: ... 5 μl of CutSmart 10x (NEB), 2 μl of BSA (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer ...
-
bioRxiv - Biophysics 2024Quote: ... 5 units of antarctic phosphatase (NEB), and 1 mM manganese chloride ...
-
bioRxiv - Genetics 2023Quote: ... 5 units of Antarctic Phosphatase (NEB) and 10 mU/µL of phosphodiesterase I (PDEI ...
-
bioRxiv - Plant Biology 2022Quote: ... 250 μL 2× lysis buffer (20 mM Tris-HCl, 40 mM Na2EDTA, 1% (w/v) SDS) and 3 μL proteinase K (NEB: P8102S, 20 mg/mL) were added and incubated under agitation at 55°C for 2 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... The restriction digest was set up directly afterwards and performed overnight at 37°C with agitation (750 r.p.m.) with HindIII (NEB; 20 µl of 20 U/µl). Using biotin-14-dCTP (Life Technologies) ...
-
bioRxiv - Plant Biology 2020Quote: ... A total of 12 sRNA libraries were constructed from 5 μg of size-selected RNA using the NEBNext® Small RNA Library Prep kit (New England Biolabs, Ipswich, MA, USA) as per the manufacturers’ instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... a 5’ RNA adapter (GCAATTAACCCTCACTAAAGGAGTCGT) lacking 5’ phosphate was ligated with T4 RNA Ligase 1 (NEB #M0204S). Ligation products were gel-purified ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation and transfected into BHK-21 cells using Lipofectamine 3000 for viral production ...
-
bioRxiv - Microbiology 2019Quote: ... with the reaction containing 5mM m7G(5′)ppp(5′)G RNA Cap Structure Analog (New England BioLabs). Resulting RNA was purified by lithium chloride precipitation ...
-
bioRxiv - Molecular Biology 2021Quote: An RNA oligonucleotide (5’-GGCATGTGATTGGTGGGTC) was 5’ labelled with gamma 32P ATP by T4 Polynucleotide Kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 5% CO2 -balanced complete cell culture medium with 5 μM SNAP-Surface Alexa Fluor 647 (NEB, S9136S), for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... or 120 μM m7G(5’)ppp(5’)G RNA Cap Structure Analog (M7; New England BioLabs #S1404S) was used ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20 U EcoRI-HF (cat. no. R3101S, New England BioLabs), and ultrapure water ...
-
bioRxiv - Microbiology 2020Quote: ... in the presence of 20 U RNase inhibitor (M0314L, NEB) for 60 min at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each PCR (20 μl) contained 1× standard PCR buffer (NEB), 1 U of Taq polymerase (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... 20 U of the restriction enzyme BstXI (New England Biolabs) were added directly to the amplification reaction and the mixture was incubated for 3 hours at 37 °C ...
-
bioRxiv - Genetics 2019Quote: ... 2 μl of 20 mg/ml proteinase K (NEB, P8107S) was added ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 2.5 μL Proteinase K (20 mg/mL; New England Biolabs), and 25 μL of 10% SDS were added to each sample ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Bovine serum albumin (BSA, 20 mg/ml, New England Biolabs) was added at a ratio of 5 -10 µg BSA per 1 µl of v-particle stock to all binding reactions to suppress non-specific binding of protein to the v-particles ...
-
bioRxiv - Bioengineering 2021Quote: ... NaCl 20 mM) with 200 μM of each dNTPs (NEB), 0.1% of Bst 2.0 WarmStart® DNA Polymerase (8,000 U/ml) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 6 µL of 20 mg/mL BSA (New England Biolabs) and 3.5 µL of 5 Weiss U/µL T4 DNA Ligase (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µl of 20 µM SpCas9 (NEB, Cat. No. M0646M) was placed in the bottom of a 0.25 ml PCR tube ...
-
bioRxiv - Microbiology 2021Quote: ... Each 20 uL reaction contained 1X Thermopol Reaction Buffer (NEB), 125uM dNTPs ...
-
bioRxiv - Microbiology 2019Quote: ... 20 units of EcoRI-HF® (New England Biolabs®) was mixed with 500 ng of isolated DNA (40 units/µg DNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μL DpnI enzyme (20 U, New England Biolabs #R0176L) was added to the 25 μL PCR mixture immediately after the final extension and incubated at 37°C for 1 hour ...
-
bioRxiv - Developmental Biology 2022Quote: ... 20 µl of the ThermoPol Buffer (New England Biolabs, # B9004S) was added to the samples and boiled for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... O-glycosidase (New England Biolabs, 20 000 U/μg protein), α2-3,6,8 neuraminidase (New England Biolabs ...
-
bioRxiv - Biophysics 2019Quote: ... with 2 μl of 20 mM BG-GLA-NHS (NEB) in 20 μl 100 mM sodium borate buffer ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 0.5 μL (20 U) of RNase inhibitor (New England Biolabs), and 2.5 μL of TGIRT-III reverse transcriptase (InGex ...
-
bioRxiv - Cell Biology 2020Quote: ... was added and incubated with 20 units ExoI nuclease (NEB) for 1 h at 37°C before purification with 42 μl AMPure beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2020Quote: ... 10 µ of 20 mg/mL BSA (New England BioLabs), and 10 µ of nuclease-free water ...
-
bioRxiv - Cell Biology 2019Quote: ... 0.45% Tween 20 and 0.4 mg/ml Proteinase K (NEB). After 5 minutes incubation at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... 4.25 μl EnGen Cas9-NLS (20 μM, New England Biolabs), 2.7 μg sgRNA at 37°C for 10 min.
-
bioRxiv - Microbiology 2021Quote: ... 10 μl of proteinase-K (NEB, stock 20 mg/ml) was added and incubated at 37°C for 1 hour ...
-
bioRxiv - Genetics 2019Quote: ... Each PCR (20 μl) contained 1× standard PCR buffer (NEB), 1 U of Taq polymerase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... 20 U of RNase murine inhibitor (NEB, Ipswich, MA, USA), 0.15 µL Cas13a endonuclease (25 nM ...
-
bioRxiv - Genomics 2022Quote: ... 1% bovine serum albumin (BSA) solution (NEB, 20 mg/mL). Nuclei were pelleted at 600 RCF for 5 minutes at 4C ...
-
bioRxiv - Genomics 2022Quote: ... and resolved on a 4–20% SDS-polyacrylamide gel (NEB). The presence of MeCP2 was assayed by western blotting using anti-MeCP2 monoclonal antibody M6818 (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 µL NEBNext Quick Ligation Reaction Buffer 5X (NEB, B6058S) and 10 µL Quick T4 DNA Ligase (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was incubated with 20 ml amylose resin (NEB) pre-equilibrated with lysis buffer for 15 mins before loading onto a gravity flow column ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 µL PCR reaction contained 1× OneTaq Master Mix (NEB), 0.2 µM of each primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by addition of 20 µl of Proteinase K (NEB) and another incubation at 65°C overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 mL ERA reaction (13 T4 DNA ligase buffer [NEB] ...
-
bioRxiv - Microbiology 2023Quote: ... Six microliters of proteinase K (20 mg/ml) (NEB, P8107S) were added ...
-
bioRxiv - Microbiology 2023Quote: ... Six microliters of proteinase K (20 mg/ml) (NEB, P8107S) were added ...