Labshake search
Citations for New England Biolabs :
251 - 300 of 10000+ citations for 20 Hydroxyecdysone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... Full-length 265 nt 5’ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Genetics 2021Quote: DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length 265 nt 5′ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...
-
bioRxiv - Genomics 2020Quote: PCR3 was performed by subtracting 2-3 cycles from the Ct and using 2.5 uL of a mix of distinct indexed primers from the NEBNext Dual Index Kit for Illumina (New England Biolabs) using 22.5 uL PCR2 product in a 50 uL reaction volume (Q5 UltraII mastermix with EvaGreen (Biotium) ...
-
bioRxiv - Microbiology 2019Quote: ... 5’ UTR reporter constructs were assembled using NEBuilder® HiFi DNA Assembly Cloning Kit (#E5520S New England Biolabs Ipswich, MA). All amplifications were carried out following the manufacturer’s guidelines ...
-
bioRxiv - Genomics 2020Quote: ... was transcribed from a sgRNA-coding PCR product with a 5′ T7 promoter sequence using HiScibe T7 Quick High yield RNA Synthesis kit (NEB). The transcription was performed at 37 °C overnight and then purified by phenol ...
-
bioRxiv - Genetics 2020Quote: ... ChIP enrichment was determined by RT-qPCR (Supplementary Table 5) prior to addition of sequencing adaptors using NEBNext Ultra II DNA Library Prep kit for Illumina (New England Biolabs). ATAC-seq was performed as previously described76 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... 5′-TAATCAGACAAGGAACTGATTA-3′ (Forward) and 5′-CGAAGGTGTGACTTCCATG-3′ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler or an Applied Biosystems StepOnePlus system ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-TAATCAGACAAGGAACTGATTA-3’ (Forward) and 5’-CGAAGGTGTGACTTCCATG-3’ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler ...
-
Lessons from the meiotic recombination landscape of the ZMM deficient budding yeast Lachancea waltiibioRxiv - Genetics 2021Quote: ... DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA synthesis was performed for 60 min at 42 °C and 5 min at 80 °C using ProtoScript II First Strand cDNA synthesis kit (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... transcripts containing artificial 5’ UTRs were performed using PCR-amplified templates and the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 °C for 5 min and 60 °C for 5 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... was generated by the assembly of 5 DNA fragments using the NEBuilder HiFi DNA assembly cloning kit (New England Biolabs). These DNA fragments ...
-
bioRxiv - Genomics 2022Quote: ... DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library Kit for Illumina (New England Biolabs) following manufacturers’ protocols ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Genetics 2020Quote: ... and wobble mutations to make constructs resistant to shOTUD5#5 were introduced in this vector using the Q5 site-directed mutagenesis kit (E0554, NEB) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA fragments were purified from the reaction using a Zymo DNA Clean & Concentrator-5 kit (in-house) and amplified with NEBNext High Fidelity PCR Mix (NEB). Library quality was assessed using a Fragment Analyzer system (Agilent) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The sgRNA was constructed by annealing sense and anti-sense single stranded oligonucleotides containing 5’ Bsa1 restriction overhangs and was inserted into Bsa1 linearized pDR274 with the Quick Ligase Kit (NEB) (Table 1) ...
-
bioRxiv - Genomics 2020Quote: ... The pbp2x 5’-end and 3’-end amplicons were spliced with the linearized pBBL740 amplicon using NEBuilder HiFi kit (New England Biolabs). The resultant spliced plasmid was transformed into parental strain MGAS27213-L601P and single cross-over transformants were selected by plating on THY agar with chloramphenicol 10ug/ml ...
-
bioRxiv - Physiology 2021Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England BioLabs), with 12 cycles of library amplification ...
-
bioRxiv - Microbiology 2021Quote: ... reverse: 5’-GATGGCGTGGAACCATGTC-3’) were obtained from the wild type plasmids pCMV-hnCoV-S via Q5 SiteDirected Mutagenesis Kit (NEB). pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward ...
-
bioRxiv - Cell Biology 2022Quote: ... 400 ng of high integrity total RNA (RIN >5) was depleted of rRNA using the NEBNext rRNA Depletion Kit (New England BioLabs). NEXTflex Rapid Directional RNA-Seq Kit (Bio-Scientific ...
-
bioRxiv - Genetics 2022Quote: The detection of aberrant Scyl1 transcripts was performed by RT-PCR using primers designed to amplify sequences between exon 2 to exon 5 (RT-Scyl1_F21 5’-CGCAGTGTCCATCTTCGTGTA-3’ and RT-Scyl1_R51 5’-CCCGGCAGTTCTGCAGGAA-3’) following the OneTaq One-Step RT-PCR Kit (New England Biolabs, E5315S) procedure ...
-
bioRxiv - Genetics 2022Quote: ... ChIP-seq libraries were prepared from 1 to 5 ng eluted DNA using NEBNext Ultra II DNA library Prep Kit (New England Biolabs) with 12 cycles of library amplification.
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of purified DNA of each template including the T7 promoter at the 5’ end was used following the manufacturer instructions (HiScribe T7 High Yield RNA Synthesis kit, NEB). Primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
bioRxiv - Microbiology 2023Quote: ... standard curve transcripts and viral RNA in the samples were reverse transcribed with a reverse E1 primer containing a nongenomic tag sequence74 5’-CAGACAGCACTCGTTCGTACAC-3’ through the Protoscript II First Strand cDNA Synthesis Kit (New England Biolabs). The (+ ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mutagenesis of csn-5(D152N) was performed using a Q5 site-directed mutagenesis kit per manufacturer instructions (New England BioLabs). For transgenic lines used in PLA ...
-
bioRxiv - Cancer Biology 2023Quote: ChIP-seq libraries were prepared using 2-5 ng of input and ChIP samples and the kit NEBNext Ultra DNA Library Prep for Illumina (New England Biolabs) following manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... purified and analyzed to quantify 5-methylcytosine levels by applying the DNA Purification Kit (T3010S, Monarch, New England Biolabs, USA) and the 5mC Assay Kit (lot no ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Developmental Biology 2024Quote: ... Complementary DNA (cDNA) was prepared from total RNA (5 μg) by reverse transcription using LunaScript® RT SuperMix Kit (NEB). qPCR reactions were performed using Power SYBR Green Master Mix (Thermo ...
-
bioRxiv - Cell Biology 2024Quote: ... Synthetic oligonucleotides encoding 3xFLAG were then ligated to the 5’ position of APEX2 sequence using NEBuilder HiFi DNA assembly kit (New England Biolabs) to form the final vector pcDNA5/FRT/TO/3xFLAG-APEX2.
-
bioRxiv - Immunology 2024Quote: ... The PCR amplicon was purified by sequential gel extraction (1.5% agarose gel prepared in 0.5x TAE) and affinity column chromatography (Monarch® PCR & DNA Cleanup Kit, New England Biolabs). For IVT synthesis ...
-
Recurrent loss of crossover interference punctuates the recombination landscape across yeast speciesbioRxiv - Genomics 2024Quote: DNA libraries were prepared from 5 ng of total genomic DNA using the NEBNext Ultra II FS DNA Library kit for Illumina (New England Biolabs). All volumes specified in the manufacturer’s protocol were divided by four ...
-
bioRxiv - Biophysics 2024Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 ◦C for 5 min and 60 ◦C for 5 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Systems Biology 2021Quote: ... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... coli (NEB 5-alpha) were used.
-
bioRxiv - Genetics 2023Quote: ... 5 U StuI (NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB), 250 U T4 DNA ligase in 1X T4 ligase buffer with the remainder nuclease-free water into a 5 µL total reaction ...
-
bioRxiv - Zoology 2023Quote: ... coli (NEB 5-alpha). We injected donor plasmids (20 ng/µl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli (NEB 5-alpha) for bacterial transformation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg BSA (NEB), 9 mM DTT ...