Labshake search
Citations for New England Biolabs :
4051 - 4100 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The linkers were pre-adenylated with a 5’ DNA Adenylation kit (NEB), and then used for the ligation reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 mM EDTA and 40 U/ml RNAse inhibitor (New England Biolabs) at 4 °C for 5 min to remove non-specifically associated proteins ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplex reaction was treated with either 5 units of RNase H (NEB) or 10εg of RNase A (Life Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... phosphorylated by T4 polynucleotide kinase at the 5’ ends (NEB, Ipswich, MA) at 37°C for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... A mix of 5 µL of 10X NEB2.1 buffer (New England Biolabs), 1.25 µL of 1 mM dATP ...
-
bioRxiv - Cell Biology 2021Quote: ... instead of dCTP and 5 U/μl Klenow fragment Dpol I (NEB) at 37°C for 2 h ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl of 400 U/μl T4 ligase (NEB M0202S/L), and incubated for 4 hours at room temperature with rotation ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was degraded using 5 units RNase H (New England Biolabs M0297) for 30 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μl of 10 U/μl T4 polynucleotide kinase (NEB; Cat#: M0201L), 1 μl of 5 U/μl Klenow DNA polymerase ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3.6 μl of 5 U/μl Klenow (exo-) (NEB; Cat#: M0212S). The reactions were carried out for 45 min at 37 °C in a PCR machine ...
-
bioRxiv - Microbiology 2021Quote: ... Dephosphorylated RNA was then 5’ end-labeled with 20U T4 PNK (NEB) and 30μCi [g32-P]ATP (Perkin-Elmer) ...
-
bioRxiv - Microbiology 2021Quote: ... and subsequently 5’-dephosphorylated with Calf intestinal alkaline phosphatase (New England Biolabs). CviAII cuts on a sequence motif ‘CATG’ which is highly frequent on bacterial genomes ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of sample was used in PCR with OneTaq polymerase (NEB) with primers Cas168 GGGACAGATACGCGTTTGAT and Cas169 GCCTAACTGAACGGTTTGA as described previously (31) ...
-
bioRxiv - Cell Biology 2021Quote: ... and tumbled with 5 μg of anti-m6A antibody (New England Biolabs) at 4°C overnight ...
-
bioRxiv - Biophysics 2020Quote: We used in vitro mutagenesis (Q-5 Site-directed Mutagenesis Kit, NEB) to introduce the mutations creating d isoforms using the following primers ...
-
bioRxiv - Biophysics 2020Quote: ... By replacing dCTP with 5-methyl-dCTP (New England BioLabs, Ipswich, MA) in the nucleotide mix ...
-
bioRxiv - Genomics 2022Quote: ... 5 mM EDTA) supplemented with Proteinase K (New England Biolabs Cat. # P8107S) was added to the beads for both ChIP and input chromatin ...
-
bioRxiv - Molecular Biology 2022Quote: 5’-end 32P-labelled DNA substrates were generated using T4 PNK (NEB) and [ɣ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Genetics 2022Quote: ... Eluted cDNA was amplified 5-cycles (NEBNextµltra II Q5 master mix (NEB) with Illumina TruSeq PCR primers RP-1 and RPI-X ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H4 (Lys 5) rabbit pAb (PTM Biolabs, SKU: PTM 313), Butyryl-Histone H3 (Lys 27 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 U/mL RNase Inhibitor (M0314S; New England Biolabs, Ipswich, MA, USA), EDTA-free protease inhibitor cocktail ...
-
bioRxiv - Microbiology 2021Quote: ... Ligations were used to transform NEB 5-alpha competent cells (NEB C2987H) and the cloned spacer was verified by Sanger sequencing using primer PSP108 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 5 μl of 10X exonuclease I buffer (New England Biolabs B0293S) was then added to each 50 μl reaction to remove unused barcoded primers and incubated at 37°C for 1 hour and then 80°C for 20 minutes ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 0.5 μl of Klenow DNA polymerase (5 U/μl NEB M0210)) and incubating in a thermocycler with the following program ...
-
bioRxiv - Biochemistry 2022Quote: ... Ea1174 and AncCDT-5(WAG) were expressed in BL21(DE3) cells (NEB): transformed cells were grown in LB media supplemented with 100 mg/L ampicillin to OD600 ∼0.7 at 37°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μL of ligation products were then transformed into competent cells (NEB). Transformation and plasmid DNA recovery were performed as previously described ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.1 μl Taq DNA Polymerase (NEB, cat#M0273S, 5 U/μl). 10.1 μl of this mastermix was added to each of the 30 μl amplicon pools and incubated for 30 minutes at 20°C followed by 30 minutes at 65°C and finally cooled to 4°C.
-
bioRxiv - Molecular Biology 2021Quote: ... and phosphorylated at the 5’ termini by T4 Polynucleotide Kinase (NEB, M0201L). The pBluescript plasmid was cut by EcoRV and dephosphorylated by Calf Intestinal Alkaline Phosphatase (CIP ...
-
bioRxiv - Microbiology 2021Quote: ... RNA samples were treated with RNA 5’ Pyrophosphohydrolase (RppH) (New England Biolabs) for 30 min at 37°C ...
-
bioRxiv - Genetics 2020Quote: ... Mutant Csde1 5’UTRs were cloned by Gibson assembly reaction (NEB, E2621S) using mutation containing ssDNA templates with homology arms and two upstream/downstream fragments.
-
bioRxiv - Biochemistry 2021Quote: ... NH4HCO3 (100 mM) and 5 units of alkaline phosphatase (CIP) (NEB, #M0525S) were added and the sample incubated for 2 hours (or 20 min ...
-
bioRxiv - Genomics 2021Quote: Purified RNA (5 ug) was reverse transcribed using Random Primer 9 (NEB) and SuperScript II reverse transcriptase under error prone conditions as described Smola et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... transformed into NEB 5-alpha chemically competent Escherichia coli (New England BioLabs), and submitted for Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was transformed into NEB 5-alpha high efficiency competent cells (NEB). Insert size was verified with PCR and purified plasmids were sequenced using Sanger sequencing.
-
bioRxiv - Microbiology 2020Quote: ... 5 μL 2x NEBnext High-Fidelity PCR Master Mix (New England Biolabs) and 2.9 μL nuclease-free distilled H2O (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.6 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB), 15% PEG ...
-
bioRxiv - Microbiology 2023Quote: The strain Escherichia coli NEB 5-alpha (New England Biolabs, NEB C2987H) was used as a cloning strain ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ phosphorylation of RNA fragments was achieved using T4 Polynucleotide Kinase (NEB) and Adenosine 5’-Triphosphate (ATP ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL of 10× rCutSmart™ Buffer (New England BioLabs, Ipswich, MA), 10 units each of SalI and EcoRV restriction enzymes (New England BioLabs ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of isolated AAVs were treated with DNAse I (NEB, M0303S) before preparing ten-fold serial dilutions ...
-
bioRxiv - Microbiology 2023Quote: The strain Escherichia coli NEB 5-alpha (New England Biolabs, NEB C2987H) was used as a cloning strain ...
-
bioRxiv - Zoology 2023Quote: ... 5 µl consisting of 1x OneTaq® PCR master mix (NEB, USA), 0 ...
-
bioRxiv - Microbiology 2023Quote: ... Each 5 uL of the reaction contained 0.5 uL of ATP (NEB), 0.5 uL DTT (1 mM final concentration) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% (v/v) T4 DNA ligase at 400 U/μL (NEB #M0202), 5% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... dinucleotide primers were 5’-labeled using T4 polynucleotide kinase (New England Biolabs) and added at 20 µM without pre-annealing to the template ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μL of ligation product was then transformed into competent cells (NEB). Transformation and plasmid DNA recovery were performed as previously described ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg purified DNA was digested overnight with HinfI and HaeIII (NEB) at 37°C and resolved on a 1% agarose gel ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 μg of total RNA were treated with DNase and CIP (NEB) to remove DNA and all non-capped RNA ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-end radiolabeled DNA was generated with T4 polynucleotide kinase (M0201L, NEB) and [γ-32P]ATP (NEG035C005MC ...
-
bioRxiv - Cell Biology 2023Quote: ... phosphorylated at 5’-termini by T4 Polynucleotide Kinase (M0201, New England Biolabs) and ligated using T4 DNA Ligase (M0202 ...