Labshake search
Citations for New England Biolabs :
4301 - 4350 of 7781 citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genomics 2024Quote: ... 4 µg of each sample was reverse transcribed using dT priming with Protoscript II (NEB, M0368L) and subsequently treated with 0.5 µL each of Rnase H and Rnase A (Thermo Fisher ...
-
bioRxiv - Genetics 2024Quote: ... Plugs were then equilibrated in NEBuffer 4 and treated with 75 U of exonuclease T (NEB) for 90 min at 24 °C.
-
bioRxiv - Biochemistry 2024Quote: ... Alkaline phosphatase treatment was performed over night at 4°C using Lambda Protein Phosphatase (#P0753S, BioLabs).
-
bioRxiv - Cell Biology 2020Quote: ... RNase H treatment on fixed cells was performed using 5 U RNase H (M0297, NEB) for 3 h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... a set of 5’-end biotinylated anti-sense DNA oligoes and 5ul RNase inhibitor (NEB) were added to the lysate ...
-
bioRxiv - Molecular Biology 2020Quote: ... oligonucleotides were 5-end labeled with 32P-γATP using T4 polynucleotide kinase (New England Biolabs). Supercoiled pUC19 plasmid dsDNA was prepared by a method that did not involve DNA denaturation (Clewell and Helinski ...
-
bioRxiv - Molecular Biology 2021Quote: 5’ RACE was performed using the Template Switching RT Enzyme Mix (New England Biolabs M0466) according to manufacturer’s instruction ...
-
bioRxiv - Genomics 2021Quote: Decapping of 5 µg total RNA was performed with 200 units of yDcpS (NEB M0463S) in 10mM Bis-Tris-HCl pH 6.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA substrates were 5’ end labeled using γ32P-ATP and T4 Polynucleotide Kinase (NEB, MA)38 ...
-
bioRxiv - Cell Biology 2021Quote: ... purified HEK-proGATI (∼5 μg) was denatured and deglycosylated using deglycosylation mix II (NEB, #P6044S), which contains the enzymes needed to remove N-linked and many common O-linked glycans ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... samples were digested for 15 min at 37 °C with 5 μL of ExoI (NEB) to remove first round primers ...
-
bioRxiv - Biochemistry 2021Quote: RNA substrates (listed in Table S1) were either 5’ labelled by T4 polynucleotide kinase (NEB) and 5’ 32P-γ −ATP ...
-
bioRxiv - Biochemistry 2020Quote: ... The 5’ phosphate of transcribed RNA ligands was removed using calf intestinal phosphatase (CIP, NEB) and then replaced with 32P using T4 polynucleotide kinase (PNK ...
-
bioRxiv - Genomics 2022Quote: ... We performed a second bead binding followed by a 5’ decapping with RppH (NEB, M0356S). RNA was phosphorylated on the 5’ end using T4 polynucleotide kinase (NEB ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of highly concentrated HhaI enzyme (150,000 U/mL, NEB; Cat. Num. R0139B-HC1), while keeping the remaining reagents as stated in the Tapestri protocol (5 μl Forward Primer Pool ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ linker ligation (1x PNK buffer, 40 U T4 RNA ligase I (NEB, Cat# M0204L), 80 U RNaseOUT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Phosphorylation of the 5’ end using T4 polynucleotide kinase (New England Biolabs, Ipswich, MA, M0201L) (iii ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Hemiligated DNA was 5’-phosphorylated with T4 PNK in T4 DNA Ligase Reaction Buffer (NEB) at 25°C for 30 minutes ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli using standard transformation techniques with NEB 5-Alpha chemically competent cells (New England BioLabs), and to C ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL proteoliposomes were mixed with 8 units of enterokinase light chain (New England Biolabs) and diluted to 20 μL ...
-
bioRxiv - Physiology 2020Quote: ... and 5 μg of the vector was linearized using restriction enzymes (NEB, Hitchin, Hertfordshire, UK). Linearized vector containing the ArCCKP cDNA were cleaned using phenol-chloroform (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μl RT mastermix (2x reaction buffer, 20 mM DTT, 4U murine RNase inhibitor [NEB] ...
-
bioRxiv - Microbiology 2021Quote: ... 5μM diphosphorylated 20mer RNA substrate was pre-treated with 0.5U/μl RNA 5’ Pyrophosphohydrolase (NEB) in 1× NEBuffer 2 (NEB ...
-
bioRxiv - Genetics 2020Quote: ... The 10 μl reactions contained 5 μl Q5 High-Fidelity Master Mix (New England Biolabs), 1 μl forward primer [10 μM] ...
-
bioRxiv - Synthetic Biology 2023Quote: All cloning was performed in NEB 5-alpha Competent Escherichia coli (New England BioLabs C2987U). The Pseudomonas putida KT2440 strain was purchased from ATCC (#47054) ...
-
bioRxiv - Microbiology 2023Quote: ... Oligos included 5’ overhangs complementary to the sticky ends generated by BsaI-HF (NEB, R3733S) restriction enzyme ...
-
bioRxiv - Genomics 2023Quote: ... the single-stranded probes were further digested with 5 units of USER enzyme (NEB M5505L) in 1x DpnII buffer at 37 °C for 3 hours.
-
bioRxiv - Biophysics 2023Quote: ... Calmodulin and myosin-5 expression plasmids were prepared from E.coli 5α cells (New England Biolabs), transformed with the each of plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 μL 20mg/ml BSA and 5 μL 400U/μl T4 DNA Ligase (NEB, M0202) overnight at 16°C (tumbling ...
-
bioRxiv - Immunology 2023Quote: ... The diluted supernatant was loaded onto a 5 mL amylose resin column (New England Biolabs). The column was washed with 150 mL of buffer I ...
-
bioRxiv - Neuroscience 2023Quote: ... 5-HT2A receptor mutants were designed and performed using Q5 mutagenesis kit (New England Biolabs). All DNA was sequence verified using Sanger nucleotide sequencing (Retrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... The assembled plasmid was introduced into Escherichia coli strain NEB 5-alpha (New England Biolabs) by heat shocking ...
-
bioRxiv - Microbiology 2023Quote: ... The resultant insert (5′-flank_SpecPromoter_kanR_3′-flank) was gel extracted (Monarch DNA GEL Extraction Kit, NEB) and added to competence peptide stimulated S ...
-
bioRxiv - Cancer Biology 2023Quote: ... Exonuclease treatment was performed by addition of 5 µL of NEBbuffer1 (NEB, cat. no. B7001S) and 1 µL of each Exonuclease I (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μM Rad51 and 10 μM (nucleotide) φX174 circular single-stranded DNA (ccsDNA) (N3023L, NEB) were mixed in reaction buffer (25 mM Tris-HCl [pH 7.5] ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 pmol of label-free RNA substrates were dephosphorylated with Alkaline Phosphatase (New England Biolabs) and labeled with [γ-32P] ATP (PerkinElmer ...
-
bioRxiv - Biochemistry 2024Quote: ... Fractions containing Cdt1 were further purified on a 5 mL amylose column (New England Biolabs) in 50 mM Tris-HCl (pH 7.8) ...
-
bioRxiv - Biochemistry 2024Quote: ... The protein was further purified on a 5-10 mL amylose column (New England Biolabs) in 50 mM Tris-HCl (pH 7.8) ...
-
bioRxiv - Cancer Biology 2024Quote: ... All ngRNAs were cloned into pLKO.5 Puro-2A-RFP between BsmBI (New England Biolabs) cut sites ...