Labshake search
Citations for New England Biolabs :
3951 - 4000 of 7437 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Protein-coding sequences for cDNA over-expression or co-immunoprecipitation were cloned into pLenti_CMV_cDNA_Flag_SV40_mCherry vector or pLenti_CMV_cDNA_HA_SV40_EGFP vector by PCR and Gibson assembly (NEB, #E2611L). All plasmids were verified by Sanger sequencing.
-
bioRxiv - Microbiology 2024Quote: ... the ahpC gene was amplified by PCR with Phusion DNA polymerase (NEB) using C ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 25 µL 2X NEBNext high-fidelity PCR master mix (NEB, M0541). To reduce GC/size bias and over amplification of libraries ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed using Q5 high-fidelity DNA polymerase (New England BioLabs) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... All PCRs were performed with Q5 High-Fidelity DNA Polymerase (NEB, M0491S) and digested with DpnI (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR was performed with Q5 Hot Start High-Fidelity Master Mix (NEB) and purified with Monarch PCR cleanup kit (NEB) ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was preformed using Taq DNA Polymerase (New England Biolabs, Beverly, MA, USA) as follows ...
-
bioRxiv - Synthetic Biology 2021Quote: ... PCRs were performed with Q5 Hot Start High Fidelity Polymerase (New England Biolabs) or Invitrogen Platinum Superfi II DNA Polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... Diluted genomic DNA was utilized for PCR analysis using Taq DNA polymerase (NEB) and genotyping primers indicated in Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and PCR-amplified with Q5 Hotstart high-fidelity 2X mastermix (NEB, Cat #M0494) and barcoding primers (Table S7 ...
-
bioRxiv - Cell Biology 2020Quote: ... The gRNA-locus is then PCR amplified with OneTaq DNA polymerase (NEB, M0480) using 1 µg of genomic DNA ...
-
bioRxiv - Cell Biology 2020Quote: PCR was conducted using Q5 High-Fidelity DNA Polymerase (New England Biolabs, M0491) according to manufacturer protocol with 400-800ng template DNA ...
-
bioRxiv - Immunology 2021Quote: ... The released DNA was cleaned up using Monarch DNA PCR Clean Kit (NEB) and eluted in TE buffer ...
-
bioRxiv - Genetics 2021Quote: ... The colony PCR amplified products were digested with AvrII (New England Biolabs R0174S) in CutSmart buffer at 37°C for 3 hours before being resolved with agarose gel electrophoresis.
-
bioRxiv - Developmental Biology 2021Quote: ... The amplicon was purified using the Monarch PCR and DNA Cleanup Kit (NEB), and 1 ug used as template for transcription of digoxigenin labelled riboprobes using the DIG RNA Labelling mix (Sigma).
-
bioRxiv - Developmental Biology 2021Quote: ... 200 ng of PCR products in 1X NEB buffer 2 (New England Biolabs) were hybridized under the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... parahaemolyticus RIMD2210633 genome via Phusion High-Fidelity (HF) polymerase PCR (New England Biolabs). The amplified 670-bp opaR coding region and pBAD33 empty vector (pBADEV ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were prepared using NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541) with the following conditions ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative PCR was completed using the Luna polymerase master mix (NEB, cat# M3003) using gene-specific primers (Table S1) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR across the 70-bp repeats were carried out with LongAmp enzyme (NEB) according to standard protocols with primers PseudoF and PACR or RFPF and VSG221R.
-
bioRxiv - Molecular Biology 2021Quote: ... The next day samples were purified using PCR cleanup kit columns (Monarch, NEB) and eluted using 50 μl kit elution buffer.
-
bioRxiv - Genomics 2022Quote: ... DNA was purified using a Monarch PCR & DNA Clean up kit (NEB, T1030) and eluted in 12 μL of water.
-
Pancreatic progenitor epigenome maps prioritize type 2 diabetes risk genes with roles in developmentbioRxiv - Genomics 2020Quote: ... Libraries were amplified using NEBNext High-Fidelity 2X PCR Master Mix (M0541, NEB) with primer extension at 72°C for 5 minutes ...
-
bioRxiv - Genomics 2020Quote: ... All PCR amplification was performed using 2X Q5 UltraII Mastermix (New England Biolabs).
-
bioRxiv - Microbiology 2020Quote: ... the source plasmid (p-retronWT) was mutagenized through PCR using a kit (NEB; Q5-Site-Directed Mutagenesis Kit ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were amplified using NEBNext High-Fidelity 2X PCR Master Mix (M0541, NEB) with primer extension at 72°C for 5 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified DNA material was PCR-amplified (18 cycles) using Phusion polymerase (NEB) and purified by MinElute PCR purification kit (Qiagen).
-
bioRxiv - Microbiology 2019Quote: ... and 1 µL used in PCR with Taq DNA Polymerase (New England Biolabs). Primers amplified the repB region of plasmids pAM714 and pAM771 (pAD1 repB-For ...
-
bioRxiv - Plant Biology 2019Quote: All PCR amplifications were performed using Q5® DNA Polymerase (New England Biolabs) according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2019Quote: ... or the Q5 Hot Start HiFi PCR master mix (New England Biolabs E6625AA) (7 - 10 cycles) ...
-
bioRxiv - Molecular Biology 2019Quote: ... RACK1-FLAG expression construct was PCR-amplified from cDNA with Phusion polymerase (NEB) with primers CACCATGACTGAGCAGATGACCCTTCGTG TTATCACTTATCGTCGTCATCCTTGTAATCGCGTGTGCCAATGGTCACCTGC CAC and cloned into pENTR D-TOPO vector ...
-
bioRxiv - Genetics 2020Quote: ... 200ng of the purified PCR-amplified oligonucleotide library was digested with SfiI (NEB) and cloned into SfiI-digested pGL4.10M vector10 using One Shot MAX Efficiency DH5-T1R Competent E.coli (ThermoFisher) ...
-
bioRxiv - Microbiology 2019Quote: ... All PCRs were performed using Phusion polymerase (New England Biolabs, Ipswich, MA, USA) and oligonucleotides synthesized by Sigma-Aldrich or Eurofins Genomics ...
-
bioRxiv - Cancer Biology 2019Quote: ... sscDNA template was amplified by PCR using the Phusion High-Fidelity enzyme (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... aureus genome were PCR amplified (Q5 Hot Start High-Fidelity DNA Polymerase (NEB)) with the primers summarised in Table S3 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The PCR was carried out using Phusion High-Fidelity DNA Polymerase (NEB #M0530) and oligonucleotides containing the promoters from clusters copAB ...
-
bioRxiv - Microbiology 2019Quote: ... Successful DNA depletion was verified with a standard PCR using Taq-Polymerase (NEB) and primers 21 and 22 binding to the 16S rDNA.
-
bioRxiv - Cell Biology 2019Quote: ... PCR reactions were supplemented with Gel Loading Dye Purple (6x) (New England Biolabs) and separated on a 2.5 % low melt agarose (BioRad ...
-
bioRxiv - Developmental Biology 2019Quote: ... HEK293 DNA was extracted and amplified by Q5 High-Fidelity PCR (NEB, M0494S) using primers encompassing the sgRNA recognition site ...
-
bioRxiv - Synthetic Biology 2019Quote: ... For cloning purposes DNA was purified using Monarch PCR & DNA Cleanup Kit (NEB) and assembled using NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Physiology 2020Quote: ... Splicing PCR was performed with Q5 High-Fidelity DNA Polymerase (New England Biolabs), and 5 μL of the cDNA was diluted 30x ...
-
bioRxiv - Synthetic Biology 2019Quote: All PCR reactions were performed using Q5 DNA polymerase (New England Biolabs, NEB) unless otherwise specified and PCR products were routinely digested overnight with DpnI and purified using a the EZ-10 Spin Column PCR Products Purification Kit (BioBasic ...
-
bioRxiv - Synthetic Biology 2019Quote: All PCR reactions were performed using Q5 DNA polymerase (New England Biolabs, NEB) unless otherwise specified and PCR products were routinely digested overnight with DpnI and purified using a the EZ-10 Spin Column PCR Products Purification Kit (BioBasic ...
-
bioRxiv - Biochemistry 2019Quote: ... PCR amplicons were digested with NcoI and SacI (New England Biolabs, Ipswich, Massachusetts), purified using the Sigma-Aldrich gel extraction kit ...
-
bioRxiv - Genetics 2019Quote: ... Each PCR reaction was treated with 1 µl of Exonuclease I (M0293, NEB) at 37 °C for 15 min followed by 80 °C for 20 min to inactivate the Exonuclease I enzyme.
-
bioRxiv - Molecular Biology 2021Quote: The 5’ RACE PCR product was digested using BamHI (New England Biolabs R0136) and EcoRV (New England Biolabs R3195 ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplicons were purified using the Monarch DNA Gel Extraction Kit (NEB, T1020S) and subjected to sequencing.
-
bioRxiv - Genetics 2020Quote: ... samples were purified by the Monarch PCR & DNA Cleanup Kit (New England Biolabs). For the library preparation ...
-
bioRxiv - Biophysics 2021Quote: ... The PCR product was digested with the DraIII restriction enzyme (New England BioLabs) for 4 hours at 37 °C to generate a 3-N-43 fragment with a 3 nucleotide (nt ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sequencing libraries were prepared using NEBNext HiFi 2× PCR Master Mix (NEB, M0541L) according to the manufacturer’s instructions ...