Labshake search
Citations for New England Biolabs :
3951 - 4000 of 5089 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE ...
-
bioRxiv - Biochemistry 2020Quote: ... were radiolabeled at the 5’-end with 32P using the manufacturer recommended protocol for T4 PNK (New England Biolabs) and ATP [g-32P] (Perkin Elmer) ...
-
bioRxiv - Biochemistry 2020Quote: ... Approximately 5 μg of each PcCel6A mutant gene in pPICZα was linearized by restriction enzyme PmeI (New England Biolabs) for the transformation of P ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ end of the digested RNA is then labelled with 10 U T4 PNK (New England Biolabs M0201) and 10 µCi [γ-32P]ATP (Perkin Elmer BLU002Z250UC ...
-
bioRxiv - Plant Biology 2021Quote: ... Digested DNA was ligated during 5 h incubation at 16 °C with 100 U of T4 DNA ligase (NEB). DNA was recovered after reverse crosslinking and Proteinase K treatment (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... 2.5 μl of reaction was added to a tube containing 5 μl replication buffer and 1 μl MseI (NEB) for 3 min ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 μg of total RNA was purified using the Poly(A) mRNA Magnetic Isolation Module (New England Biolabs, Massachusetts). Libraries were constructed using the ULTRA II directional library kit (New England Biolab ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in 18.5 μL T4 DNA Ligase Reaction Buffer with 5 μL of 10 μM annealed Broken end linker and 1.5 μL T4 DNA Ligase (#M0202S, New England Biolabs). The reaction was incubated 18-20 h at 16°C with constant mixing ...
-
bioRxiv - Cancer Biology 2021Quote: ... We performed 5 or 20 Gibson assembly reactions for tiling or genome-wide sgRNA library followed by manufacturer’s instructions (NEB) and purified DNA using ethanol precipitation ...
-
bioRxiv - Biochemistry 2022Quote: ... Reactions contained approximately 5 μL of isothermal assembly mix (prepared similar to as previously described12) or NEBuilder HiFi (NEB), 0.01 pmol of plasmid linearized via SpRYgest ...
-
bioRxiv - Genomics 2022Quote: ... Cells were fixed with 3% paraformaldehyde in PBS for 10 min at room temperature and permeabilized for 5 min on ice in PBS containing 0.5%Triton X-100 and 2mM Vanadylribonucleoside complex (New England Biolabs). Coverslips were preserved in 70% EtOH at -20°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’end of RNA was phosphorylated and labelled by γ-[32P] ATP using T4 Polynucleotide Kinase (New England Biolabs) at 37°C for 45 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ncas_Int679_For 5′ GGCAAATTTGTATGAGGGATAAA and Ncas_Int679_Rev 5′ TAATTCGATTACGTTAGCTGTT) and cloned into pRS403-pGAL1-hpSC_URA3 (1) using PsiI and NaeI restriction enzymes (New England Biolabs, NEB). In addition ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads were then washed once in 5 volumes of binding buffer (100μL, 1xPBS containing 1mg/mL of BSA (NEB)) for 10 minutes at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4(wACBD5_FFAT)/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Cancer Biology 2020Quote: ... pre-existing histones were first quenched by incubating cells with 5 µM SNAP-cell Block (New England Biolabs; S9106S) for 30 min at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... or RCC970 in 50 μl total volume containing 5 μl 10x Q5 Reaction Buffer (NEB, Frankfurt am Main, Germany), 0.5 U of Q5 High-Fidelity DNA Polymerase (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: Every single stranded oligonucleotide (1 nmol) was 5’-end-phosphorylated with 40U of T4 Polynucleotide kinase (New England Biolabs) by incubation at 37°C in 1x T4 DNA Ligase Reaction Buffer.
-
bioRxiv - Biochemistry 2020Quote: ... 14 nucleotides in length (TIBMOL BIOL, Berlin) were radioactively phosphorylated with [32γP] dATP at their 5’ ends using phosphokinase (NEB) following the manufacturer protocol and used as a length standards.
-
bioRxiv - Molecular Biology 2022Quote: ... Up to 5 μg of gDNA was digested with 15 U of SalI-HF® enzyme (NEB, Cat# R3138L) for 3 hr at 37°C and separated on 0.9% agarose gel for 16 hr at 50 V ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The total volume reaction was 25 μl with the following composition: 5 μL 10× buffer at 1.0 mM (New England BioLabs), 0.1 mM each dNTP ...
-
bioRxiv - Biochemistry 2019Quote: ... All sens RNA strands were labeled at their 5’ end with [γ-32P] ATP using protein nucleotide kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... the beads were resuspended in 75 μL of ChIP Dilution Buffer and 5 μL of BSA (New England BioLabs) and incubated at 4°C overnight with rotation for blocking ...
-
bioRxiv - Microbiology 2020Quote: ... and the 5’ ends of the DNA (25 nM) were radiolabeled using T4 polynucleotide kinase (PNK, New England Biolabs). Excess ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μM of each forward and reverse primer (Supplementary Table 1) and 2.5 U Long Amp Taq Polymerase (NEB) in a total volume of 25 μL ...
-
bioRxiv - Bioengineering 2019Quote: The pcDNA 3.1 NCadTS expression construct was generated using overlap extension PCR [5] using Phusion Polymerase (New England BioLabs). The forward and reverse primers 5’ CCA CAG TAC CCA GTC CGA TCC GCA GCC ATG GTG AGC AAG GGC GAG GAG ACC ACA ATG GGC 3’ ...
-
bioRxiv - Genomics 2021Quote: ... Ligation was done overnight at 16°C also rotating at 900rpm for 10 seconds every 5 minutes by adding 120μl of 10X ligation buffer (NEB), 664μl water ...
-
bioRxiv - Biochemistry 2021Quote: ... The mixture was incubated at room temperature for 10 min followed by transformation into 5-alpha competent cells (NEB). The E ...
-
bioRxiv - Bioengineering 2020Quote: ... Then 5 μl extracted RNA was fragmented at 94°C for 9 minutes by using 0.2× fragmentation buffer (NEB) before conducting the nanoswitch detection ...
-
bioRxiv - Developmental Biology 2022Quote: ... Ligation was done overnight at 16°C also rotating at 900rpm for 10 seconds every 5 minutes by adding 120µl of 10X ligation buffer (NEB), 664µl water ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 5 µL of the ligation mixture was added to 50 µL of chemically competent NEB10β cells (New England Biolabs) and transformation was performed following manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... and plasmid IRES sequence (IRES_rev) using 5% of the genomic DNA as a template and Q5 polymerase (New England Biolabs - NEB) at 100 μL scale ...
-
bioRxiv - Molecular Biology 2020Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE and transferred to a nitrocellulose membrane (Protran) ...
-
bioRxiv - Microbiology 2021Quote: ... and npmA F and npmA_R, respectively (Table S5) Assembled vectors (Figs. S4C, S4D) were transformed into NEB 5-alpha (New England Biolabs), selecting for ampicillin and gentamicin resistance ...
-
bioRxiv - Genomics 2020Quote: ... Capture plate wells contained 5 µl of capture solution (1:500 Phusion High-Fidelity Reaction Buffer, New England Biolabs; 1:250 RnaseOUT Ribonuclease Inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... a total of 100 ng of SED vector construct was digested with 5 U of I-SceI meganuclease (NEB) at 37°C for 10 minutes in a 10 μL reaction mixture ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5S and Saba PCR products were purified using Monarch® PCR & DNA Cleanup Kit (5 μg) (NEB, # T1030). The purified DNA sequence was then analyzed through Sanger sequencing (GENEWIZ from Azenta ...
-
bioRxiv - Cancer Biology 2022Quote: ... new SNAP-tagged histones were pulse-labeled for 30 min with 5 μM final SNAP-biotin (New England Biolabs) diluted 1:200 in 10% Duolink blocking buffer (Sigma-Aldrich ...
-
bioRxiv - Zoology 2023Quote: ... We performed 5 PCR enrichment with 15 cycles (30 ng DNA input, NEB Phusion High-Fidelity PCR Master Mix) for each library to increase fragment diversity ...
-
bioRxiv - Microbiology 2024Quote: ... the protein eluted from MonoQ 5/50 GL was incubated with 10 μM SNAP-Surface Alexa Fluor 647 (NEB) for 1 hour at 4°C prior to gel filtration.
-
bioRxiv - Molecular Biology 2022Quote: ... The total isolated gDNA was processed in batches of 5 µg per PCR reaction with Q5 polymerase (NEB M0491L). One PCR reaction contained 10 µl 5x reaction buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... the fragment and vector were mixed in a 5:1 ratio and ligated with T4 DNA Ligase (NEB, M0202L) overnight at 16°C ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid pEC095 was digested with BtsBI and the 5’ overhanging DNA ends were filled in with T4 Polymerase (NEB). A kanamycin resistance marker ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... The elution was then ligated to 5′ barcoded RNA adapters using T4 RNA ligase 1 (New England Biolabs, #M0204). To reduce ligation biases ...
-
bioRxiv - Genetics 2024Quote: ... DNA digested overnight with XhoI was further digested for ∼5 h with HF-BamHI or NgoMIV (New England Biolabs). Digested DNA was precipitated using standard ethanol/ sodium acetate precipitation.
-
bioRxiv - Cancer Biology 2024Quote: ... RNA was dephosphorylated by incubation with 5 U T4 Polynucleotide Kinase in 1X T4 PNK Buffer (New England BioLabs) supplemented with SUPERaseIn RNase Inhibitor for one hour at 37°C and ligated to bar-coded linkers (NI-810 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µL of the assembly product was used to transform 50 µL of DH5α chemically competent cells (NEB #C2987I) according to the manufacturer’s high-efficiency transformation protocol ...
-
bioRxiv - Genetics 2023Quote: ... were ligated overnight at 20°C with a mix of six 5’ phosphorylated telorette oligonucleotides (0.1 µM each) and 2,000 units of T4 ligase (NEB Inc.) in a 50 µl reaction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Each library was split in two and transformed separately into 5-alpha cells (NEB, 3.5uL DNA in 35uL cells). Plasmid library isolation ...
-
bioRxiv - Molecular Biology 2023Quote: ... To obtain dephosphorylated TOP2B used for in vitro kinase assay and mass spectrometry the YFP column incubated twice for 15 min at room temperature in wash buffer supplemented with 0.1mM MnCl2 and 5 units mL-1 calf intestinal phosphatase (NEB), 400 units mL-1 lambda protein phosphatase (NEB) ...