Labshake search
Citations for New England Biolabs :
3851 - 3900 of 5089 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... A-tails were added by incubating DNA in 1x NEB buffer 2 (New England Biolabs B7002S) with the addition of 200uM dATP and 7.5 units Klenow (exo- ...
-
bioRxiv - Molecular Biology 2021Quote: ... Long (HMSpAa) and short (HMSpBb) splinkerette adaptors were first resuspended with 5X NEBuffer 2 (NEB, B7002) to reach a concentration of 50uM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Chromosomal and plasmidic DNA was removed by treatment with 2 units of DNase1 (New England Biolabs) for 2 hours at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 & 2; New England Biolabs). Number of PCR cycles was calculated using a real-time qPCR-based approach (Lion et al. ...
-
bioRxiv - Genomics 2022Quote: ... a 2 μl mix of 6.4 U of Exo I (New England Biolabs, Ipswich, MA, USA), 32 U of Exo III (New England Biolabs ...
-
bioRxiv - Genomics 2022Quote: ... 2 μL of 10 mM i5 primer and 25 μL of 2x NEBNext Master Mix (NEB). The following PCR conditions were used ...
-
bioRxiv - Immunology 2022Quote: ... and IgGC-TBGH fragments into part 2 using NEBuilder HIFI DNA Assembly Mastermix (New England BioLabs). Following reaction 1 ...
-
bioRxiv - Plant Biology 2022Quote: Reverse transcription was performed using 2 µg of total RNA and M-MuLV Reverse Transcriptase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... aliquots of 200 ng nucleic acid were treated with 2 U DNase I (New England Biolabs), 10 U S1 nuclease (Thermo Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... for 2 min and DNA was removed with DNase I (New England Biolabs, Beverly, MA, USA). during the RNA purification ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubating 1.6 µM of annealed gRNA with 2 µM Engen Cas9 enzyme (New England Biolabs) at 37°C for 10min ...
-
bioRxiv - Molecular Biology 2022Quote: ... for 2 hours at 37°C in 1X T4 PNK buffer (New England Biolabs, cat#B0201S). Radioactively labeled tRNAs were produced by T7 in vitro transcription in the presence of [α-32P]-UTP (PerkinElmer ...
-
bioRxiv - Genomics 2022Quote: ... cells were digested for 2 hours at 37°C using 375U of MboI (NEB, Cat. #R0147). After biotin filling ...
-
bioRxiv - Plant Biology 2024Quote: ... Mixed tissue sections and reaction reagents: 2 μl 10× Tag DNA polymerase (NEB, Cat. No. M0267V), 0.4 μL Buffer Tag DNA polymerase (5 U/μL ...
-
bioRxiv - Immunology 2024Quote: ... The region of interest was then amplified using Q5 2× mastermix (New England Biolabs, cat. M0492S), 500 ng of template DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Ligation was performed in 25% PEG 8000 (61) by T4 RNA Ligase 2 Truncated K227Q (NEB) for 8 h at 16°C ...
-
bioRxiv - Genetics 2024Quote: ... and libraries were generated by PCR with NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541). Prior to sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... the samples were end-repaired by adding 2 μl NEBNext FFPE DNA Repair Mix (NEB, M6630) and 3 μl NEBNext Ultra II End Prep Enzyme Mix (NEB ...
-
bioRxiv - Genomics 2024Quote: ... 2.) Size fractionation was performed using the NEBNext Ultra II FS DNA module (New England Biolabs), 3. ...
-
bioRxiv - Genomics 2023Quote: 1-2 µg of extracted total RNA and polysomal RNA was treated with DNaseI (NEB, M0303) in a 100 µL reaction at 37 °C for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µM each of gene- specific forward and reverse primers and 1 unit Phusion polymerase (NEB) were mixed in 1X HF Phusion buffer and 3% (v/v ...
-
bioRxiv - Plant Biology 2023Quote: ... the pMIR319C containing pMW#2 reporter constructs were linearized with XhoI (R0146, New England Biolabs, USA) and integrated into the mutant HIS3 locus of the YM4271 host strain (Gift from Ram Yadav ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of purified PCR product and 1 µl of NEB 2 Buffer (New England Biolabs) in 9.5 µl total volume were first denatured for 5 min at 95°C and then rehybridized by cooling the sample at a rate of 2°C/s to 85°C and a rate of 0.1°C to 25°C to obtain potential heteroduplex DNA ...
-
bioRxiv - Genomics 2023Quote: ... an aliquot of approximately 10 μg of RNA was treated with 2 units of DNase (NEB) in a final volume of 100 μL for 10 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... mmpL10 and papA3 and the flanking intergenic sequence was amplified using Q5 HiFi 2× MasterMix (NEB) from genomic DNA isolated from M ...
-
bioRxiv - Neuroscience 2022Quote: The Gr64f promoter was PCR amplified using Q5 High-Fidelity 2× Master Mix (New England Biolabs) from the Gr64f-GAL4 (107 ...
-
bioRxiv - Genetics 2022Quote: ... 25 µl LongAmp Hot Start Taq 2’ Master Mix (New England BioLabs, Frankfurt am Main, Germany). The PCR program was 94°C for 1 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Systems Biology 2023Quote: ... 400 µL of RNAlater and 2 µL of 20 mg/mL BSA (New England Biolabs # B9000S) were added to the samples and incubated on ice for 5 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were placed on ice for 2 minutes before adding 250 µL SOC medium (Biolabs #B9020S). The transformed cells in medium were incubated in a shaker for 1 hour at 37°C and 225 RPM ...
-
bioRxiv - Cancer Biology 2023Quote: ... and preadenylated linkers were ligated to the RNA fragments using T4 RNA Ligase 2 K277Q (NEB). After 5’ deadenlyase and RecJ exonuclase treatment ...
-
bioRxiv - Biochemistry 2023Quote: ... Riboswitch samples were prepared by splinted ligation using T4 RNA ligase 2 (New England Biolabs M0239S). 5 nanomoles each of the 5’ and 3’ segments of the riboswitch and the DNA splint were combined and heated to 90 °C for 2 minutes and then allowed to cool to RT over 10 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... 40 U/mL Rnasin) and then resuspended in ligation buffer plus 2 μM SplintR Ligase (NEB). Cells were incubated for 1h at 37 ºC with gentle agitation.
-
bioRxiv - Molecular Biology 2023Quote: crRNA (Supplementary Table 2) was synthesized using a HiScribe T7 High Yield RNA Synthesis Kit (NEB). The DNA sequences includes the T7 promoter at the 5’ end and the sequence from crRNA with the target sequence at the 3’ end ...
-
bioRxiv - Genetics 2024Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2; NEB E7335 and E7500). Library DNA was quantified using the Qubit ...
-
bioRxiv - Biochemistry 2024Quote: ... incubated for 2 hours at 30 ° C and stopped by addition of 0.2 U apyrase (NEB), incubated at 30 ° C for 20 mins ...
-
bioRxiv - Cancer Biology 2024Quote: ... the pLenti CRISPR V2 was digested for 2 h at 50°C with Bsmb1 (NEB, R0580S) and the resulting digested fragment was purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel ...
-
bioRxiv - Genomics 2024Quote: A ligation reaction was then assembled by combining 2 μl 10x T4 DNA ligase buffer (NEB), 1 μl annealed 20 μM Index_A_XX stock ...
-
bioRxiv - Systems Biology 2024Quote: ... 66U/μl truncated T4 ligase 2 and 13U/μl murine RNAse inhibitor (all from NEB, USA)) were added at 25°C for 1h ...
-
bioRxiv - Systems Biology 2022Quote: ... 5’-AAAC(N)19-20-3’) by combining 1 μl of each 100 μM oligonucleotide with 1 μl of 10× T4 ligation buffer (NEB cat. no. B0202S), 6.5 μl of water ...
-
bioRxiv - Genomics 2022Quote: ... and then ‘A’ base was added to 3’ blunt ends using the A-Tailing reaction (NEBNext® UltraTM II End Repair/dA-Tailing Module, NEB, Cat. E7546). The purified A-tailed DNA was ligated with adaptors from the Ligation Sequencing Kit (SQK-LSK109 ...
-
bioRxiv - Genomics 2019Quote: ... 3 μg RNA was used to generate sequencing library by using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA). PCR was carried out using Phusion High-Fidelity DNA polymerase ...
-
bioRxiv - Neuroscience 2019Quote: ... The cassette was amplified by PCR then ligated to the donor template using Gibson Assembly Master Mix (NEB, primers in Supplementary Table 3). The reaction was incubated at 50 °C for 15 minutes ...
-
bioRxiv - Cell Biology 2022Quote: Living ovaries were incubated at room temperature in SNAP solution containing 3 μM SNAP- Cell TMR-Star or SNAP-Cell 647SiR (New England BioLabs, S9105S and S9102S), 10% FCS and 0,2 mg/ml Insulin in Schneider’s medium ...
-
bioRxiv - Neuroscience 2019Quote: ... We designed custom adaptors (Table S5) which were directly ligated to the 3’ ends of RNA using RNA ligase 1 (NEB Cat. No. M0437) and truncated RNA ligase KQ (NEB M0373) ...
-
bioRxiv - Zoology 2021Quote: ... a total of nine RNA libraries were prepared with 3 μg RNA using NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) following manufacturer’s recommendations ...
-
bioRxiv - Plant Biology 2021Quote: ... Detection of editing in the EBE region of CsLOB1 promoter was performed by amplifying the target region (primers in Supplementary Table 3) with high fidelity DNA polymerase Q5 (New England Biolabs, Ipswich, MA, USA), followed by cloning of PCR products and sequencing.
-
bioRxiv - Microbiology 2022Quote: ... We then used 1:3 insert to vector ratio in a 1 hour Hifi assembly reaction using NEBuilder HiFi DNA Assembly kit (NEB, Cat. No. E2621). After the HiFi assembly ...
-
bioRxiv - Physiology 2024Quote: ... and PCR was performed with Flag F (caaggacgacgatgacaaagtc) + 3’OUTR (CAGAGCCAACAACGTGAGGT) primers using Q5® High-Fidelity DNA Polymerase (New England Biolabs, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... hereafter called Flag-SERCA2-C) were constructed from 3×Flag-SERCA2 using a Q5 Site-Directed Mutagenesis Kit (New England BioLabs, Ipswich, MA, USA). mCherry-Sec61B (Addgene ...