Labshake search
Citations for New England Biolabs :
351 - 400 of 1692 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... locus using the primers ubb polyA fw: 5’-TAGAACCGACAGTCTTAGGGATGG-3’ and ubb polyA rv: 5’-GAATTCATTGCCATCAAGTGTTAGC-3’ with Phusion High Fidelity DNA Polymerase (NEB M0530S), subcloned into the Zero Blunt TOPO PCR Cloning vector (Invitrogen K283020) ...
-
bioRxiv - Genomics 2023Quote: ... using 0.3 μM of dual-indices primers (forward: 5’:AATGATACGGCGACCACCGAGATCTACACCTCCAAGTTCACACTC TTTCCCTACACGACGCTCTTCCGATCT-3’; reverse 5’-CAAGCAGAAGACGGCATACGAG ATCGAAGTATACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAGCAAACTGGGG CACAAGC-3’) and amplified using Q5 2X master mix (NEB #M0541S) according to the following protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Bioengineering 2024Quote: ... This strategy avoids 3’-terminal editing of the mismatched primers by the 3’-5’ exonuclease activity of Q5® High-Fidelity DNA Polymerase (NEB), increasing PCR specificity.61
-
bioRxiv - Molecular Biology 2024Quote: ... was used to repair the sonicated DNA and successively 3’ A-tails were added by Klenow Fragment (3’→5’ exo-) (NEB, M0212S) and dATPs (NEB ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl of 400 U/μl T4 ligase (NEB M0202S/L), and incubated for 4 hours at room temperature with rotation ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The NEBNext® Ultra II FS DNA module (cat# NEB #E7810S/L) and the NEBNext® Ultra II Ligation module (cat# NEB #E7595S/L ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and the NEBNext® Ultra II Ligation module (cat# NEB #E7595S/L) were used to process the samples ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-rabbit IgG (H+L) (DyLight™ 800 4X PEG Conjugate, NEB) or anti-mouse IgG (H+L ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and the NEBNext® Ultra II Ligation module (cat# NEB #E7595S/L) were used to process the samples ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The NEBNext® Ultra II FS DNA module (cat# NEB #E7810S/L) and the NEBNext® Ultra II Ligation module (cat# NEB #E7595S/L ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and the NEBNext® Ultra II Ligation module (cat# NEB #E7595S/L) were used to process the samples ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The NEBNext® Ultra II FS DNA module (cat# NEB #E7810S/L) and the NEBNext® Ultra II Ligation module (cat# NEB #E7595S/L ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2.5 U/μL SplintR Ligase (Cat No. M0375 L, NEB, Beijing, China), 1 U/μL RiboLock RNase Inhibitor (Cat No ...
-
bioRxiv - Bioengineering 2024Quote: ... A mastermix containing 2 mmol/L of each dNTP (NEB, Ipswich, MA), 4.5 µg of random hexamers (ThermoFisher ...
-
bioRxiv - Bioengineering 2023Quote: (Optional) OneTaq Quick-Load 2X Master Mix (NEB cat. No. M0486S/L), for genotyping only
-
bioRxiv - Bioengineering 2023Quote: NEBuilder HiFi DNA Assembly Master Mix (NEB cat. no. E2621S/L/X)
-
bioRxiv - Bioengineering 2023Quote: Q5 Hot Start High-Fidelity DNA Polymerase (NEB, cat. no. M0493S/L)
-
bioRxiv - Immunology 2022Quote: ... and L DNA was generated with HindIII-HF (New England Biolabs, USA). A CIMac pDNA 0.3 mL weak anion-exchange analytical column (Sartorius ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 3’ adenine overhangs were added to the blunt-end DNA fragments by Klenow Fragment (3’-5’ exo; NEB; Cat. No. M0212L). The DNA fragments were then ligated with diversity-increased custom barcodes (Shi et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was PCR amplified using primers: 5’-gaagaaatgaatttgccagg-3’ and 5’-ctcatgttcttcttgggc-3’ and Phusion DNA Polymerase Master mix (New England Biolabs, Ipswich, MA). DNA was sent for Sanger Sequencing to check for reversion mutations.
-
bioRxiv - Molecular Biology 2021Quote: ... The repair template was made by annealing oligos described in Supplementary File 3 and extending the 3’ ends using Phusion Polymerase (New England Biolabs, Beverly, MA). SIR3 overexpression strain and its control strain was created by transformation and maintenance of 2-micron plasmids pJR3526 and YEp24 ...
-
bioRxiv - Microbiology 2020Quote: ... and one fragment of about 320 bp of the 3’-terminal region by 3’ RACE were amplified using Phusion High-Fidelity PCR Kit (New England Biolabs, MA, USA) under the following conditions [98°C ...
-
bioRxiv - Neuroscience 2022Quote: ... the full-length msi1 or msi2 human cDNA and the msi-1 3’UTR were fused to a 3 kb fragment of the rig-3 promoter using NEBuilder Hifi DNA assembly (New England Biolabs, Ipswich, MA).
-
bioRxiv - Microbiology 2022Quote: ... and we amplified mEmerald including vector sequence but omitting the mitochondrial targeting sequence from the mEmerald-Mito-7 plasmid using primers mEmeraldVector forward (5’ TGGATCCATGGGGGATCCACCGGTCGCC 3’) and mEmeraldVector reverse (5’ ACACCGACATGCTAGCGGATCTGACGGTTCAC 3’) and combined the fragments using a HiFi assembly kit (New England Biolabs, Ipswich, MA) to create a plasmid expressing CHMP4B-mEmerald ...
-
bioRxiv - Plant Biology 2022Quote: The pVecBar-Rht13 construct contained a 6,998 bp fragment including 2,532 bp upstream and 450 bp downstream regions amplified from Magnif mutant genomic DNA using primers Rht13-NotF2 (5’ AATGCGGCCGCAATCGATAGGAGAGCTGCGTCTGTGTG 3’) and Rht13-AscR2 (5’ TGCGTACGGCGCGCCGAGAGTCGCCTTGCCAGTTC 3’) with Phusion® High-Fidelity DNA Polymerase (NEB, USA). pVecBarIII is a derivative of pWBvec8 (Wang et al. ...
-
bioRxiv - Genetics 2023Quote: The yeast plasmids recovered after thermoselection were subject to a shortened PCR with 15 cycles with oligonucleotide pairs oWS1408 (5°-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCAGCATATAATCCCTGCTTTA-3°) and oWS1409 (5°-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGGGGTGGTGCAAACTATG-3°) using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA) to attach overhang sequences ...
-
bioRxiv - Biochemistry 2023Quote: ... and “frq segment 4F” (5’-CACCGATCTTTCAGGAGACCCTG-3’) and “frq segment 4R” (5’-CACTCAGGTC TCAATGGTGA TG-3’) pair with pCB05 digested with FseI (NEB, Catalog # R0588S) and MluI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... “frq segment 3F” (5’-GTCGCACTGGTAACAACACCTC-3’) and “frq segment 3R” (5’-CAGCACATGTTCAACTTCATCAC-3’) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... primers “frq segment 2F” (5’-GTGAGTTGGAGGCAACGCTC-3’) and “frq segment 2R” (5’-GTCCATATTCTCGGATGGTA-3’ were used for PCRs in combination with pCB05 digested with XhoI (NEB, Catalog # R0146S) to NruI (NEB ...
-
bioRxiv - Genetics 2023Quote: ... PCR-derived DNA fragments were generated by pairing oWS1359 (5°-TATGATTCCGATGAAGAAGAACAAGGTGGCGAAGGTGTACAATGT-iTriMix20-iTriMix20-iTriMix20-TGATTTTCTTGATAAAAAAAGATC-3°) and oWS1308 (5°-CAGCATATAATCCCTGCTTTA-3°) and pWS1728 template using a high-fidelity Q5 polymerase (New England Biolabs, Ipswich, MA). The PCR products were purified (Omega E.Z.N.A Cycle Pure kit ...
-
bioRxiv - Microbiology 2024Quote: ... The variable region V3+V4 of the 16S rRNA gene was amplified using a broad-range primer pair (338F: 5’-ACTCCTACGGGAGGCAGCA-3′, 806R:5′-GGACTACHVGGGTWTCTAAT-3′) using the Phusionâ High-Fidelity PCR Master Mix (New England Biolabs, Beverley, MA). The PCR amplification program was as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... padlock probe ligation was performed overnight O/N at 25°C using the SplintR ligase (NEB, M0375) at a final concentration of 0.5 Units/μl ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of N protein was dissolved in 36 μL H218O and 2 μL 10x glycobuffer (NEB). To this solution 2 μL PNGase F was added and the reaction mixture was incubated at 37 °C for 16 h ...
-
STARCH SYNTHASE 4 is required for normal starch granule initiation in amyloplasts of wheat endospermbioRxiv - Plant Biology 2021Quote: ... in frame with the N-terminal His6-tag using the Gibson assembly master mix (New England Biolabs) for TaSS4-1B ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 μL of endo-β-N-acetylglucosaminidase-H (Endo-H, EC 3.2.1.96) (New England Biolabs™) and incubated in the thermomixer at 37 °C for one h ...
-
bioRxiv - Microbiology 2019Quote: ... the product was cloned into the pET1-5b N-terminal 6×His expression plasmid (New England Biolabs).
-
bioRxiv - Cell Biology 2020Quote: ... then deglycosylated with 2000 U of Peptide-N-Glycosidase F (PNGase F) (New England BioLabs, MA, USA). All samples were incubated for 16 hours at 37°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... N-linked glycans released from glycoproteins using Peptide:N-glycosidase F (PNGase F, New England Biolabs, Ipswich, MA) were mixed with 2,5-dihydroxybenzoic acid (DHB ...
-
bioRxiv - Biochemistry 2021Quote: The full-length PARP1 gene was purchased from GE Healthcare and subcloned into a pACEBac1 plasmid bearing an N-terminal 6xHis-tag via a Gibson Assembly (NEB). The PARP2 expression plasmid (C-terminal FLAG-6xHis-tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... with a cleavable Glutathione-S-Transferase (GST) tag at the N-terminus) and pMALTMc5X (New England Biolabs, USA ...
-
bioRxiv - Neuroscience 2023Quote: ... Generation of Adgrd1 N-terminal mutations was carried out using Q5 site directed mutagenesis kit (NE Biolabs) using manufacturers protocol ...
-
bioRxiv - Cell Biology 2023Quote: cDNA encoding recombinant MUC17(7TR) with N-terminal 3xFlag tag was generated using Gibson Assembly (E2611S, NEB) following the manufactures protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cascade complexes were purified via the N-terminal maltose binding protein (MBP) tag using amylose beads (NEB) and eluted with lysis buffer containing 10 mM maltose ...
-
bioRxiv - Genetics 2023Quote: We performed n=30 PCR1 reactions per sample using Q5 High Fidelity 2X Master Mix (NEB #M0429S) with 10 ug of genomic DNA to maintain ≥1000X representation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cole) containing an N-terminal 6×His-tag using NEBuilder HiFi DNA Assembly Master Mix (NEB E2621L). The LSD1 constructs were expressed in BL21-CodonPlus (DE3)-RIPL competent E ...
-
bioRxiv - Microbiology 2020Quote: ... followed by 3’ adaptor ligation using T4 ligase (NEB). The ligated products used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... followed by 3′ adaptor ligation using T4 ligase (NEB). The ligated products were used for reverse transcription with SSIII (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µL murine RNase Inhibitors (40 U/µL NEB) and 125 µM NTP-mix (NEB) ...