Labshake search
Citations for New England Biolabs :
501 - 550 of 1692 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: N-terminal strep-6xHis-TEV mTagBFP2 RanQ69L was cloned into the pST50 vector via Gibson Assembly (New England Biolabs). The plasmid was transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: Sec24D was subcloned from pEGFP Sec24D into pcDNA3.1 with an N-terminal myc-6xHis tag using Gibson Assembly (E5510, New England Biolabs). pcDNA3.1 was linearized with Not1 (R3189 ...
-
bioRxiv - Biophysics 2020Quote: ... with TEV-cleavable 6x-His tag at N-terminal of the gene cloned between NheI (New England Biolabs Inc.) and HindIII (New England Biolabs Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a total volume of 20 µL containing 10 U of T4 RNA Ligase 1 (NEB, cat n° M0204L), 1X T4 RNA ligase buffer ...
-
bioRxiv - Microbiology 2020Quote: ... The Cas9/gRNA expression construct pTREX-n-Cas9 was first modified using the Q5 mutagenesis kit (NEB, Ipswich, Massachusetts), primers 5’-CCCAAAAAGAAAAGGAAGGTTGATTAGAAGCTTATCGATACCGTCGAC-3’ and 5’-GTCCTCGACTTTTCGCTTCTTTTTCGGGTCGCCTCCCAGCTGAGA-3’ ...
-
bioRxiv - Microbiology 2019Quote: ... Pellets were resuspended in PBS and in some cases treated with N-glycosidase F (PNGase F; New England Biolabs), according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Microbiology 2023Quote: ... Enzymatic deglycosylation was performed on denatured PrPres with 1,000 U of recombinant PNGase (peptide N-glycosidase F; New England Biolabs) for 2h at 37°C in 1% Nonidet P40 and the manufacturer’s buffer.
-
bioRxiv - Neuroscience 2022Quote: Proteins from neuronal culture at DIV 14 were extracted as described above and treated with and without N-glycanase or endoglycosidase H according to manufacturer’s instructions (New England Biolabs). The lysates were analyzed with Western blot using LAMP1 (1:4000 ...
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA template of the SARS-CoV-2 N gene was synthesised using in-vitro transcription (Hiscribe, NEB, US) and a template plasmid (Molecular Diagnostics Collection ...
-
bioRxiv - Microbiology 2023Quote: ... Cloning of the expression vector was performed using NEBuilder HiFi DNA Assembly Master Mix (Gibson cloning) and was performed according to manufacturer’s guidelines (cat. n° E2621L, New England Biolabs). In addition ...
-
bioRxiv - Microbiology 2023Quote: ... PCR analysis of total DNA extracted from oysters (N=60) used the high fidelity Q5 polymerase (New England Biolabs) in a total volume of 50 μL under the following conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... N- and C-terminal linkers of R-iLACCO0.1 were deleted using Q5 high-fidelity DNA polymerase (New England Biolabs) to provide variants with different linker length ...
-
bioRxiv - Biochemistry 2023Quote: ... Antibody de-N-glycosylation was carried out by incubating the sample with PNGase F (New England Biolabs, Ipswich, MA) for 24 hrs at 37 OC (enzyme:substrate ratio ca ...
-
bioRxiv - Biochemistry 2024Quote: ... a vector containing an N-terminal Thioredoxin-His10 tag using a Gibson Assembly® Cloning Kit (New England BioLabs). Plasmids were extracted and transformed into competent E ...
-
bioRxiv - Plant Biology 2024Quote: ... and SLAC1 cDNAs (N-terminal or C-terminal) were cloned in-frame into pMAL-c5X vector (New England Biolabs) using In-Fusion HD Cloning Kit (Takara Bio) ...
-
bioRxiv - Biochemistry 2021Quote: ... Enzymatic deglycosylation of NTD was carried out by adding 2.5 L Endo Hf (NEB) per 20 μg of NTD and incubating for 24 hrs at 25 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... Deletion mutants of hnRNP L and SETD2 were constructed by PCR (Phusion polymerase, NEB) using full-length hnRNP L and SETD2 ...
-
bioRxiv - Microbiology 2022Quote: ... purified using the Monarch RNA Cleanup Kit (T2050S/L, New England Biolabs, Ipswich, Massachusetts), reannealed by heating to 94°C and slowly cooling to room temperature over 50 min ...
-
bioRxiv - Genomics 2022Quote: ... The NEBNext® Ultra DNA Library Prep kit for Illumina (cat# NEB #E7370S/L) was used to process the DNA samples ...
-
bioRxiv - Cell Biology 2023Quote: ... RNAs were selected using the NEB Next Poly A+ Isolation Kit (NEB #E7490S/L). Poly A+ fractions were eluted ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 uL of Taq polymerase (New England BioLabs, Ipswich, MA, USA), 1 uM of 50 mM MnCl2 ...
-
bioRxiv - Cell Biology 2020Quote: H4-SNAP histones were labelled with 3 μM TMR fluorophore (NEB) for 30 min in complete medium ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of 10x NEBuffer 3 (cat#B7003, New England Biolabs), and 13 µl of water were incubated in a thermocycler (cat#EP950040025 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’-triphosporylated RNA was capped with 3’-desthiobiotin-TEG-GTP (NEB)) using the Vaccinia virus Capping enzyme (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... then free 3 adaptors were degraded using 5 deadenylase (NEB, M0331) and RecJf (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 μL of 20 mg/mL Proteinase K (NEB EO0491) was added to each sample ...
-
bioRxiv - Microbiology 2020Quote: ... and 3’-end dephosphorylated by 10 U T4-PNK (M0201S, NEB) in the presence of 20 U RNase inhibitor (M0314L ...
-
bioRxiv - Microbiology 2020Quote: ... For 3’ adaptor ligation the NEBNext Small RNA Kit (E7560S, NEB) was used ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 μl of USER enzyme (New England Biolabs; cat. no. M5505) were mixed with 16 μl of adapter-ligated DNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Bioengineering 2019Quote: Single stranded plasmid master mix (3x): 3 U/µL Nb.BbvCI (NEB), 36 U/µL Exonuclease III (ExoIII ...
-
bioRxiv - Immunology 2021Quote: ... and 375 U/mL of Klenow Fragment (3’-5’ exo-) (NEB). After cDNA synthesis and subsequent purification by AMPure XP (Beckman Coulter) ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 μl (0.5 μl per sample volume) of RNase If (NEB) was added and the sample was incubated at 37 °C for 15 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... mixed with 3 µL 10% SDS and 1.8U Proteinase K (NEB), and incubated for 1 hour at 50°C ...
-
bioRxiv - Molecular Biology 2022Quote: 3’-end 32P-labelled gapped DNA was generated using TdT (NEB) and [α-32P]dATP (PerkinElmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 μl of USER enzyme (New England Biolabs; cat. no. M5505) were mixed with 16 μl of adapter-ligated DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were fixed in 1:3 glacial acetic acid:methanol (Biolabs-chemicals) solution and the G-banding karyotype was determined ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 2.5 μl of T4 DNA polymerase (3 U/μl NEB M0203), 2.5 μl of T4 PNK (10 U/μl ...
-
bioRxiv - Genomics 2022Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs). Illumina sequencing adapters were then ligated to DNA ends using Quick Ligase (New England Biolabs) ...
-
bioRxiv - Genetics 2019Quote: ... 3 U/µl T4 DNA polymerase (5 µl; New England Biolabs) and nuclease-free water (up to 100 µl) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.5 μl T4 DNA Polymerase (NEB, cat#M0203S, 3 U/μl) and 0.1 μl Taq DNA Polymerase (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 µL NEBNext End Prep Enzyme mix (New England Biolabs, USA), 2.5 µg fragmented DNA and adjusted to 50 µL with nuclease free water (Qiagen ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... ligated to a 3’ adaptor using T4 RNA Ligase I (NEB), and purified using SDS-polyacrylamide gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Genomics 2021Quote: ... mixed with 3 μL 10% SDS and 1.8U Proteinase K (NEB), and incubated for 1 hour at 50°C ...
-
bioRxiv - Biophysics 2020Quote: ... GRN-3 was expressed in SHuffle™ cells (New England Biolabs), while GRN-5 was expressed in Origami 2 DE3 (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... EcoRI-HF (5’ GAATTC 3’) (New England BioLabs Inc., Ipswich, MA). gDNA samples that showed poor banding patterns or could not be digested by the enzymes listed above were then digested with Taq⍺I (5’ TCGA 3’ ...
-
bioRxiv - Biophysics 2020Quote: ... mixed with 3 μL 4x LDS loading dye (New England Biolabs) and loaded onto 4-12% NuPAGE Bis-Tris gels (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2021Quote: ... in NEB next Quick ligation buffer (3 μl, New England Biolabs) in the presence of 1 μl RNA CS (Oxford Nanopore Technologies ...