Labshake search
Citations for New England Biolabs :
601 - 650 of 1692 citations for N BOC 3 FLUORO L TYROSINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... using a plasmid that codes for the desired protein sequence fused to an N-terminal intein and chitin binding domain (CBD) as part of the IMPACT purification system (NEB). 2 liters of cells were grown to an OD600 of 0.6 and induced with 1 mM IPTG for 3 hours at 25 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The fragment of sNTurboID was PCR amplified from pLX304 CMV FKBP-V5-sTurboID (N) and cloned into the pcDNA5-VP35-HA using NEBuilder HiFi DNA Assembly Master Mix (NEB). The fragment of VP35-sNTurboID ...
-
bioRxiv - Cancer Biology 2020Quote: ... were added to each quadrant of the 96-well plate (n = 24 unique adapters) with a ligation mixture of 40 Weiss U T4 ligase (NEB), 1mM ATP (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Microbiology 2021Quote: ... Point mutations were introduced in the P and N sequences by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (New England Biolabs). Sequence analysis was carried out to check the integrity of all constructs ...
-
bioRxiv - Genetics 2020Quote: ... An 18-mer poly-N barcode was created by annealing primers (Table S1) and extended to make fully double stranded with Klenow polymerase (NEB). The barcode was then PCR purified (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing an N-terminal 6xHis tag and TEV site was produced in Escherichia coli NiCo21 (DE3) cells (New England Biolabs) as previously described in https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6069193/ ...
-
bioRxiv - Microbiology 2022Quote: ... Mutations to the specificity of guides in pTREX-n-Cas9 were performed using a Q5 mutagenesis kit (NEB, Ipswich, Massachusetts). Guides targeting the ELO genes were inserted using the primers described in Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... and Atd1 and containing an N-terminal TEV cleavage site were cloned directly via Gibson assembly (NEBuilder HiFi, New England Biolabs) into BamHI/NotI-digested pGEX4-1 (GE Healthcare) ...
-
bioRxiv - Plant Biology 2024Quote: ... in an N-terminal fusion (MIROs are tail anchored proteins) with mCherry that was generated by Gibson assembly (New England Biolabs, Ipswich ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reporter loxP-2272 was generated by substituting the lox17:N site (ATAACTTCGTATAGTATACCTTATAGCAATTTAT) within loxP-N with the lox17:2272 site (ATAACTTCGTATAGGATACTTTATAGCAATTTAT) using a Q5 Site-Directed Mutagenesis kit (New England Biolabs) and PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... Library preparation was slightly different and performed using the NEBNext® rRNA Depletion kit and protocol (NEB; P/N: E7850X) per manufacturer recommendations ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCR8[mZC3H18] plasmid was used as a template to generate subsequent ZC3H18 cDNA constructs that were cloned into a piggyBAC (pB) vector containing an N-terminal MYC tag and BSD selection marker using NEBbuilder HiFI DNA assembly (NEB). OsTIR1-HA ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was inserted into a gel-purified N-terminal sub-cloning vector digested with MluI and KpnI restriction enzymes (New England Biolabs). Cas13 C-terminal fragments were also PCR amplified out of the full Cas13 sequence templates mentioned above to contain a 5′ sequence to code for the KpnI restriction site a start codon ...
-
bioRxiv - Cell Biology 2023Quote: ... was fused in frame to the N-terminus of LRRK2 between the PreScission recognition sequence and NotI restriction site using HiFi assembly (NEB). A plasmid encoding Rab8 was previously generated in the De Camilli lab.
-
bioRxiv - Microbiology 2023Quote: ... Point mutations were introduced in the N sequence by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (New England Biolabs). Sequence analysis was carried out to check the integrity of all constructs ...
-
bioRxiv - Bioengineering 2023Quote: ... TADs were directly fused to the N-terminus to dCas9 by digesting the FLAG-NLS-MCS-linker-dCas9 plasmid with AgeI (NEB) and then cloning in PCR-amplified TADs using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... All hybrid constructs were tested for expression and cloned into the pcDNA5/FRT/TO-N-FLAG-hBirA* using restriction enzymes: 5’ KpnI (NEB) and 3’ NotI (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... double and triple N>G mutations were introduced in the parental constructs by using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) according to the manufacturers protocols and using custom designed primer ...
-
bioRxiv - Biochemistry 2023Quote: ... Cleared lysate containing the nucleosomes was incubated with purified MBP-tag or MBP-FoxP3ΔN protein (1uM) for 1 hour at 4℃ and then subjected to MBP pulldown using Amylose Resin (New England Biolabs). After proteinase K (New England Biolabs ...
-
bioRxiv - Cancer Biology 2024Quote: ... Shipston and was N-terminally attached to an RFP (BKCa-DECRFP) using KpnI and BamHI restriction sites after PCR amplification (NEB Q5 High-Fidelity DNA-Polymerase ...
-
bioRxiv - Microbiology 2024Quote: ... Ligation with gentamycin cassette PCR amplified from the plasmid pACEBac1 (GenevaBiotech) was performed O/N at 16 °C using T4 DNA Ligase (NEB). Competent E ...
-
bioRxiv - Molecular Biology 2022Quote: The NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (NEB #E7370S/L) was used to prepare DNA sequencing libraries ...
-
bioRxiv - Microbiology 2023Quote: ... NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB #E7645S/L) was used for library preparation and libraries were sequenced on Illumina MiSeq or NextSeq 2000 platform and more than 1.25M read pairs of 150bp length were generated per sample i.e ...
-
bioRxiv - Cell Biology 2019Quote: ... and YQDA (D434W Y415A A463W Q433W) fused to a mCherry N-terminal tag were cloned using the NEBuilder HiFi DNA Assembly Cloning Kit (NEB #E5520) and introduced into pBlueScriptII with a VHA-6 promoter and tub terminator using the primers pvha6_fwd gacggtatcgataagcttgatatcggtatactatttattactcgatacttttg ...
-
bioRxiv - Genomics 2019Quote: ... DNA libraries were prepared at the Fundación Parque Científico de Madrid (FPCM) using NEBNext® Ultra™ II DNA Library Prep Kit for Illumina (New England Biolabs) and purified with Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Bioengineering 2021Quote: ... the Lenti_Split-BE4-N-Blast plasmid24 was digested with restriction enzymes AgeI and BamHI (New England Biolabs (hereafter, for brevity, NEB)) and a MEGAquick-spin total fragment DNA purification kit (iNtRON Biotechnology ...
-
bioRxiv - Biochemistry 2020Quote: ... The dried glycoproteins were incubated with trypsin for 16 h at 37°C before releasing N-glycans using PNGase F (New England Biolabs, MA). Liberated N-glycans were separated from glycopeptides by C18 Sep Pak SPE cartridges (Waters Corporation ...
-
bioRxiv - Cancer Biology 2020Quote: ALC1 cDNA was cloned into a retroviral pOZ-N vector as well as in a pMSCV-puromycin vector using Gibson Assembly (NEB, E5510S) with an N-terminus FLAG-HA tag ...
-
bioRxiv - Biochemistry 2022Quote: ... was cloned into pGex6P-1 in-frame with an N-terminal 3C-cleavable GST tag using HiFi assembly (New England Biolabs, USA).
-
bioRxiv - Microbiology 2020Quote: ... 66 and 51 bp fragments were amplified by PCR using as template the cDNA obtained from infected Arabidopsis plants with designated primer pairs introducing EcoRI at the N-terminal and XhoI (NEB, CAD) at the C-terminal end (Table S1) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was generated from RNA using 4 µL of 5X ProtoScript II buffer (cat. n° M0368L, NEB, New England Biolabs, USA), 2 µL of 0.1 M Dithiothreitol (cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was subjected to end repair and dA-tailing reaction using NEBNext End repair/dA-tailing module (NEB, cat. n°E7546S) following the manufacturer’s instruction and incubated for 5 min at 20°C and then 5 min at 65°C ...
-
bioRxiv - Microbiology 2020Quote: ... Mutations to the specificity of guides in pTREX-n-Cas9-noTags was performed using a Q5 mutagenesis kit (NEB, Ipswich, Massachusetts). Guides targeting the mitochondrial glutamate dehydrogenase (mGDH ...
-
bioRxiv - Biochemistry 2022Quote: ... Deglycosylation was performed using Peptide-N-Glycosidase F (PNGase F) at 37 °C for one hour according to the supplier’s protocol (New England Biolabs, Hitchin, UK). Enzyme purity and molecular weight were estimated by 12 % SDS-PAGE using mini-PROTEAN 3 system (BioRad ...
-
bioRxiv - Cell Biology 2022Quote: ... An IFT144 construct lacking the N-terminal β-propeller domain (residues 2–349 inclusive; IFT144ΔNFLAG) was made using the Q5® Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Biochemistry 2022Quote: ... Deglycosylation was performed using Peptide-N-Glycosidase F (PNGase F) at 37 °C for one hour according to the supplier’s protocol (New England Biolabs, Hitchin, UK). Enzyme purity and molecular weight were estimated using a 12% SDS-PAGE and mini-PROTEAN 3 system (BioRad ...
-
bioRxiv - Biophysics 2024Quote: ... The N-glycans of Fc were unified by adding 1 nmol of β1-4 Galactosidase S (New England Biolabs, Tokyo, Japan) per 1 unit of glycan terminus (mixed so that the enzyme solution was 10% of the total reaction solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... Ribosome protected RNA fragments were 3’ dephosphorylated with T4 polynucleotide kinase (NEB) in 150 mM MES-NaOH pH 5.5 ...
-
bioRxiv - Genomics 2021Quote: ... and 150 μg chromatin was immunoprecipitated using 3 μg H3K18la (PTM Biolabs) overnight at 4°C with gentle rotation (20 rpm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 3 μL DNase I (both New England Biolabs, Ipswich, MA, USA) was added to 30 μL of the mixture and incubated for 22 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 30 μg was diluted 1:3 in gel loading buffer (NEB), sonicated ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3’ end dephosphorylation was performed with T4 polynucleotide kinase (New England Biolabs) before addition of a pre-adenylated linker using RNA ligase (New England Biolabs) ...
-
bioRxiv - Genomics 2020Quote: ... and SalI (5’-GTCGAC-3’, New England Biolabs Inc., MA, CA#R3138S) restriction enzymes ...
-
bioRxiv - Genomics 2021Quote: ... The 3’ adapter was ligated using truncated T4 RNA ligase 2 (NEB) without prior 3’ repair to select against degraded RNA fragments ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3.5 µL of 3 U/µL T4 DNA Polymerase (New England Biolabs) was added to each sample ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and A-tailed using Klenow (3′-5′ exo-; New England Biolabs M0212L). Illumina-compatible adapters were subsequently ligated to DNA ends ...