Labshake search
Citations for New England Biolabs :
351 - 400 of 1831 citations for 8 10 Heneicosadiynoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and 2µl 10× GlycoBuffer 2 (NEB) buffer at 37°C 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl 10% NP-40 (NEB) and 2µl 10× GlycoBuffer 2 (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli 10-betaTM (New England Biolabs). White colonies (indicating the absence of GFP ...
-
Vps18 contributes to phagosome membrane integrity in Mycobacterium tuberculosis-infected macrophagesbioRxiv - Microbiology 2023Quote: ... 10 μl of Proteinase K (NEB) was then added ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL 10 mM dNTPs (NEB), 2 µL each 10 µM forward and reverse primers ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 mM pNPP (New England Biolabs) was added to 4 µM PPTC7 in the presence or absence of either 5 mM MnCl2 or 5 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli ligase (10 U/μL, NEB); 2 μL of DNA polymerase I (10 U/μL ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 10 units of PNK (NEB) in a total volume of 25µl PNK buffer 1X ...
-
bioRxiv - Genomics 2020Quote: ... 2.5 μl of 10 μM NEBNext i5 and 2.5 μl of 10 μM NEBNext i7 primers (NEB) in a final volume of 50 μl ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed and phosphorylated sgRNA (1:10) and T4 Ligase reaction buffer (1:10, #B0202S, New England Biolabs) with 10 mM 10x Adenosine 5’-Triphosphate (#P0756S ...
-
bioRxiv - Genetics 2020Quote: ... 10 mL of a 10% BSA solution was incubated with 2.5 μL of Proteinase K (NEB P8107S) for 30 minutes at room temperature (∼22°C) ...
-
bioRxiv - Genomics 2024Quote: ... 25 µL 10x CutSmart buffer and 10 µl 10 U/µL MseI restriction enzyme (New England Biolabs) were added ...
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: Reverse transcription was performed by adding the following to the above reaction: 8 uL of 5x first strand buffer (NEB E7330L), 2 uL of 10mM dNTPs (each) ...
-
bioRxiv - Molecular Biology 2021Quote: ... was resuspended in 10x NEB CutSmart Buffer (8:1) and dephosphorylated by incubation with Quick calf intestinal phosphatase (CIP) (NEB, # M0525S) at 37 °C for 20 min ...
-
bioRxiv - Biochemistry 2020Quote: ... and 8 pmol of purified DNA was then used for in vitro transcription with T7 RNA polymerase (New England Biolabs Inc.). The resulting RNA was purified with Agencourt RNAClean XP beads supplemented with an additional 12% of PEG-8000 (3 volumes of 40% PEG-8000 was added to 7 volumes Agencourt RNAClean XP beads ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Biochemistry 2021Quote: ... The RNAs were recovered from the gel slices by digesting the protein with proteinase K (8 U; P8107S, NEB, Ipswich, MA) leaving a polypeptide remaining at the crosslinked nucleotide ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 5 min and then samples were incubated with ligation buffer (8 μl of 5x ligation stock (New England Biolabs, USA), 1 μl ligase and 31 μl of ultrapure water on each coverslip ...
-
bioRxiv - Microbiology 2020Quote: ... The flies were homogenised in 100 μl of TE-buffer pH 8 containing 1% Triton X-100 and 1% Proteinase K (NEB, P8107S). Homogenates were incubated for 3 h at 55°C followed by a 10 min incubation step at 95°C ...
-
bioRxiv - Microbiology 2021Quote: A549 cells were infected with PR8 at a MOI of 5 and lysates were collected every two hours post infection (hpi) until 8 h RNA extraction was performed with Monarch total RNA Miniprep kit (New England Biolabs GmbH) according to manufacturers’ instructions ...
-
bioRxiv - Physiology 2022Quote: ... RNA-Seq libraries were prepared using the NEBNext Ultra Directional RNA Library Kit with 12 cycles of PCR and custom 8 bp indexes (New England Biolabs, UK). Libraries were multiplexed and sequenced on the Illumina HiSeq4000 as 75-nucleotide paired-end reads ...
-
bioRxiv - Microbiology 2021Quote: ... Then the product was incubated with 8 pmol of adapter and 3000 units T4 DNA ligase (MGI, 1000004279) in 80 μL of 1X PNK buffer (NEB, B0201S) with extra 1 mM ATP and 7.5% PEG-8000 at room temperature for 1 hour ...
-
bioRxiv - Genomics 2023Quote: ... DNA fragments were further size-selected by agarose gel elution and PCR amplified for 6 to 8 cycles using Illumina P1 and Index primer pair and Phusion® High-Fidelity PCR Master Mix (New England Biolabs). The final library was purified using Agencourt AMPure XP beads and quality assessed by Agilent Bioanalyzer 2100 (DNA 7500 kit ...
-
bioRxiv - Biophysics 2023Quote: ... on whose product we generate sticky ends and remove remaining pUC19 templates by a triple digest in 1X Cutsmart buffer with 8 μl SacI-HF (NEB, R3156S), 8 μl XhoI (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted fragments were amplified by PCR with an appropriate number of PCR-cycles (5-8) using Custom NExtera PCR primers50 and the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S). Amplified DNA was purified using Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 0.8 μL of this was then used to template an 8 μL PCR using LongAmp® Hot Start Taq 2X Master Mix (M0533, NEB) with each amplification containing a unique combination of forward and reverse sequencing-barcoded primers that were cherry-picked into PCR reactions using Echo 525 with a 384PP plate as was done in the construction ...
-
bioRxiv - Cancer Biology 2023Quote: ... The end-repaired DNA was ligated with 5 μl Adapter Mix (ONT, SQK-LSK110) using 8 μl NEBNext Quick T4 DNA ligase (NEB, E6056) at 21°C for up to 1h ...
-
bioRxiv - Biochemistry 2024Quote: ... in vitro transcription templates were prepared via 8 cycles of PCR using 2x Q5 Master Mix (New England Biolabs, Cat. M0492S) with a T7 promoter containing forward primer as previously described ...
-
bioRxiv - Genetics 2020Quote: Total RNA was extracted using the standard hot acid phenol method and treated with DNase 1 (New England Biolabs). qRT-PCR was performed using amfiRivert cDNA synthesis Platinum Master Mix from Gendepot ...
-
bioRxiv - Biochemistry 2021Quote: ... The alkyne-PAR was purified to remove excess alkyne-PEG1-amine using the Monarch Nucleic Acid Cleanup Kit (NEB) following the recommended protocol ...
-
bioRxiv - Biophysics 2019Quote: ... 115 amino acids) fused to the C-terminus of maltose binding protein (MBP) in pMALX vector (New England Biolabs), MBP-5-HT3A-ICD-pMALX ...
-
bioRxiv - Biochemistry 2021Quote: ... 70 and 80 amino acids deletion mutants were carried out with the Q5 mutagenesis kit (New England Biolabs, MA). All AtAtm3 constructs were overexpressed in Escherichia coli BL21-gold (DE3 ...
-
bioRxiv - Synthetic Biology 2022Quote: Genomic DNA was purified from single-humanized Hsα1 and quintuple-humanized Hsα1,α2,α3,α4,α7 strains using the Monarch Nucleic acid purification kit according to the manufacturer’s protocol (NEB). Spheroplasts were obtained before the genomic DNA extraction for a high-quality DNA prep ...
-
bioRxiv - Biochemistry 2023Quote: ... Single or multiple amino acid mutations in full-length GPR161 were generated using Q5 site-directed mutagenesis kit (NEB).
-
bioRxiv - Biophysics 2023Quote: ... Single-amino acid exchanges were generated by Q5® site-directed mutagenesis (New England Biolabs GmbH, Frankfurt am Main) using the appropriate primer pairs which were designed by using NEBaseChanger ...
-
bioRxiv - Microbiology 2023Quote: 20 ng of nucleic acid was enriched for viral genomic sequences using NEBNext Microbiome DNA Enrichment Kit (NEB, E2612) to reduce host genomic DNA contamination ...
-
bioRxiv - Cancer Biology 2023Quote: Pellets were resuspended in 99.25 µL micrococcal nuclease reaction buffer (1:10 micrococcal nuclease 10 x buffer (NEB), 1:100 10 mg/mL BSA in distilled water ...
-
bioRxiv - Cell Biology 2024Quote: ... Library samples were enriched with 11 cycles of PCR amplification in 50uL of total reaction volume (10uL 5x KAPA buffer, 1.5uL 10 mM dNTPs, 0.5uL 10 mM NEB Universal PCR primer ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl 10 mM ATP (NEB, 0756), 1 µl 100 mM DTT (Cell Signaling Technology Europe ...
-
bioRxiv - Cell Biology 2020Quote: ... and 10% NP-40 (New England Biolabs) at 37°C for 60 mins.
-
bioRxiv - Genetics 2021Quote: ... 10 μL of Proteinase K (NEB, P8107S) was added to each sample and the sample was mixed well by pipetting ...
-
bioRxiv - Molecular Biology 2021Quote: ... Antarctic phosphatase from NEB (# M0289S-10 units), snake venom phosphodiesterase I (0.2 units ...
-
bioRxiv - Genomics 2022Quote: ... 10 μl of T4 DNA ligase (NEB), and 3 μl of nuclease-free water ...
-
bioRxiv - Genomics 2022Quote: ... and 10 units of Exonuclease V (NEB) in nuclease-free water ...
-
bioRxiv - Genomics 2019Quote: ... 5 µL PNK (10 U/µL, NEB) was added ...
-
bioRxiv - Genomics 2019Quote: ... 0.3 µL of 10 mM ATP (NEB) and 0.33 µL of nuclease-free water ...
-
bioRxiv - Microbiology 2019Quote: ... 10 U of RNase Inhibitor (Murine, NEB), 0.5 mM each dNTP mix and 5 mM DTT in a final volume of 10 μL ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 µM (nucleotide) linear φX174 dsDNA (NEB) was added to the mixture to initiate the three-strand exchange reaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 μl 10mM ATP (New England Biolabs), 2 μl T4 ligase (New England Biolabs) ...