Labshake search
Citations for New England Biolabs :
451 - 500 of 1831 citations for 8 10 Heneicosadiynoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 10 μl Large Klenow Fragment (NEB #M0210L) was added and the chromatin is incubated for 15 min at 37°C with shaking ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM ribonucleoside-vanadyl complex (NEB, S1402S)) and incubated overnight at 37°C in a humidified chamber ...
-
bioRxiv - Molecular Biology 2023Quote: ... or with 10 µL RNaseH (NEB # M0297S) for 30 min at 37°C.
-
bioRxiv - Molecular Biology 2024Quote: ... 10 U of T4 Polynucleotide Kinase (NEB) and 40 U Murine RNase Inhibitor (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... 10 µM of dNTPs (New England Biolabs) and 10 µM of primer XhoI-T7-5’ [AGCTCTCGAGACCATGAACACCATCAATATTGCC] and EcoRI-§-T7-3’ [GCATGAATTCTCAGGCAAATGCGAAATCGGA] ...
-
bioRxiv - Biophysics 2024Quote: ... 10 units of calf intestinal phosphatase (NEB), 5 units of antarctic phosphatase (NEB) ...
-
bioRxiv - Plant Biology 2021Quote: ... The final library products were further purified using an 8% polyacrylamide gel to excise 130-160nt products relative to the pBR322 DNA-MspI Digest ladder (New England Biolabs, Cat# E7323AA). The purified libraries were pooled and sequenced (single end 50 bp ...
-
bioRxiv - Microbiology 2019Quote: ... 10 (GSF1697) or 12 (GSF2248) PCR cycles were run using 8-nt barcoded oligos from NEBNext Multiplex Oligos barcode kit (NEB cat# 6609S). The libraries were purified with Agencourt AMPure XP beads ...
-
bioRxiv - Genomics 2022Quote: ... samples were gently removed from the chamber and digested overnight at 37°C in 8 U mL-1 proteinase K (NEB, cat# P8107) in digestion buffer (1× TAE buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were amplified for 9 cycles for the hepatocyte libraries and 8 cycles for the liver organoid libraries using Phusion® High-Fidelity PCR Master Mix (NEB, M0531S) with the Nextflex primers ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were split into two separate reaction tubes containing 8 μL of PCR product + 1 μL 10X NEB® Buffer #2 (New England Biolabs®). These were incubated in a thermocycler with an initial denaturation of 95 °C for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... the cDNA of RDGB corresponding to amino acids 947-1259 was subcloned in pJFRC::GFP vector using the restriction enzymes BglII and NotI (NEB). A flexible linker of Gly(G)-Ser(S ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA coding region corresponding to RDGBPITPd-FFAT (amino acids 1-472) was subcloned into pUAST-attB by using the restriction enzymes NotI and XbaI (NEB). Similarly ...
-
bioRxiv - Microbiology 2022Quote: ... of the SNAP-Tag-SCE-I-KanR shuttle sequence with a nine amino acid linker (HTEDPPVAT) and subsequent second recombination to clear the Kanamycin resistance and restore the SNAP-Tag sequence (NEB; for complete insertion sequence see Table 1) ...
-
bioRxiv - Cell Biology 2019Quote: ... The CLN6ΔL2 construct was obtained by removing the codons for amino acids 155-222 using the Q5 Site-Directed Mutagenesis kit (New England Biolabs).
-
bioRxiv - Genomics 2019Quote: ... Site-directed mutagenesis for Exd and Hth was performed via amplification of the original plasmid with primers harboring single amino acid replacements (arginine to alanine) using Taq-polymerase (NEB). Double and triple mutations were generated consecutively ...
-
Long-Range Electrostatic Interactions Significantly Modulate the Affinity of Dynein for MicrotubulesbioRxiv - Biophysics 2021Quote: ... We mutated aspartic acid 3420 to alanine (D3420A) and glutamic acid 3320 to alanine (E3320A) using a Q5 site-directed mutagenesis kit (E0552S, New England Biolabs, Ipswich ...
-
bioRxiv - Microbiology 2020Quote: ... Constructs with single amino acid substitutions in SctD or SctF were created by overlapping PCR using Phusion polymerase (New England Biolabs), and expressed from an arabinose controlled expression vector (pBAD).
-
bioRxiv - Biochemistry 2022Quote: ... the serine residues S240 and S250 in Dsn1 were mutated to aspartic acid using the Q5 site-directed mutagenesis kit (New England Biolabs) as described previously 19,20 ...
-
bioRxiv - Microbiology 2022Quote: ... and a subpart of it encoding specifically the PAS domain (amino acids 1-138) the corresponding coding sequence was amplified by PCR using the Phusion DNA polymerase (New England Biolabs) and cloned between the NdeI and BamHI sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... Amino acid substitutions and domain deletions were made using either Gibson assembly or the Q5 Site-Directed Mutagenesis Kit (NEB). Isogenic single and double mutant strains were generated via haploid mating ...
-
bioRxiv - Biophysics 2019Quote: ... The EC3-5 domains were created by deleting amino acids 28-262 for PCDH15 and 25-228 for CDH23 using site-directed mutagenesis (New England Biolabs). This strategy preserved the native signal peptide sequence ...
-
bioRxiv - Genomics 2021Quote: ... Site-directed mutagenesis for amino acid substitution was performed using the Q5® Site-directed mutagenesis kit (New England Biolabs) according to the manufacture’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid was made by inserting the TauRD sequence (Tau amino acids 244-371) in pHUE82 by Gibson assembly using the Gibson Assembly Master Mix (New England Biolabs). Plasmid pHUE-TauRD (C291A/P301L/C322A/V337M ...
-
bioRxiv - Cell Biology 2020Quote: ... A fragment of human Plexin-B1 cDNA (encoding amino acids 1-535) was cloned into the pcDNA5 vector using HindIII (R0104S, NEB) and XhoI (R0146S ...
-
bioRxiv - Cell Biology 2021Quote: ... Single or multiple amino acid mutants of TULP3 and ARL13B were generated by Q5 site directed mutagenesis (New England Biolabs). For biotinylation experiments ...
-
bioRxiv - Cell Biology 2019Quote: ... the cDNA of RDGB corresponding to amino acids 947-1259 was subcloned in pJFRC::GFP vector using the restriction enzymes BglII and NotI (NEB). A flexible linker of Gly(G)-Ser(S ...
-
bioRxiv - Microbiology 2023Quote: ... A stop codon was inserted after amino acid residue 370 by site directed mutagenesis using Q5 Site-Directed Mutagenesis Kit (NEB), in order to express the truncated N1-370 construct ...
-
bioRxiv - Biochemistry 2023Quote: ... serine or aspartic acid were generated by engineering the corresponding constructs using Q5 site-directed mutagenesis (New England Biolabs, E0554). For this purpose ...
-
bioRxiv - Biophysics 2023Quote: ... and 575-585 for ΔX-Y contact) were replaced with a 12 amino acid GSSG linker using the KLD enzyme mix (NEB). Expression and purification were carried out the same as for the wildtype protein ...
-
bioRxiv - Cell Biology 2023Quote: ... was inserted into murine Shh between amino acids 92N and 93T (corresponding to N91 and T92 in human Shh) by using Gibson assembly (HiFi Assembly Kit, NEB). Where indicated ...
-
bioRxiv - Bioengineering 2024Quote: ... containing 0.06 % pluronic acid (F-127, final concentration) and 1 µL of each disulfide bond enhancer 1 and 2 (NEB #E6820). We used droplet oil consisting of 3M™ Novec™ HFE7500 Engineered Fluid (3M ...
-
bioRxiv - Microbiology 2024Quote: Amino acids substitutions in ompT were generated using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... site-directed mutagenesis of the codon encoding lysine at amino acid position 41 was altered to alanine using the Q5 site-directed mutagenesis kit (New England Biolabs) using pPM11 as a template ...
-
bioRxiv - Biophysics 2021Quote: ... in 500 μl T4 ligase buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP and 10 mM DTT, pH 7.5, NEB). Before adding the ligase ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM MgCl2, 10% Glycerol, 0.05% NP-40, 2 mM DTT, 10 mM Ribonucleoside-Vanadyl complex [New England Biolabs, MA USA] ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 nM tritiated pSP1 was nicked either using 50 nM Cas12a RNP (WT protein with crRNA 24) at 25°C in Buffer RB for 10 s or using 10 units Nt.BspQI (New England Biolabs) per µg DNA ...
-
bioRxiv - Genomics 2023Quote: ... were mixed in 5 μL of 1x T4 DNA Ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM ATP, 10 mM Dithiothreitol; New England Biolabs) at a final concentration of 80 μM each and annealed by heating at 65 °C for 15 min ...
-
bioRxiv - Systems Biology 2023Quote: ... with 10 µL RT mix (5 µL 5x Maxima RT Buffer, 1.25 µL 10 mM/each dNTP [New England Biolabs #N0447S] ...
-
bioRxiv - Microbiology 2021Quote: ... The digested DNA (4 ml in total) was split into 4 aliquots and diluted in 8 ml ligation buffer (1X ligation buffer NEB 3 (without ATP), 1 mM ATP ...
-
bioRxiv - Biochemistry 2023Quote: ... In vitro methylation experiments were performed for 10 min (DNA) or 1 h (RNA) at 37 °C in 8 μL reaction mixtures containing 1× CutSmart buffer (New England Biolabs Inc., Massachusetts, USA) with 20 nM DNA or 50 nM RNA with 1 unit RNase Inhibitor (New England Biolabs Inc. ...
-
bioRxiv - Genetics 2024Quote: ... of 8 or greater were subjected to Poly-A enrichment using the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB catalog number E7490). NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (catalog number E7760L) ...
-
bioRxiv - Developmental Biology 2024Quote: ... of 8 or greater were subjected to Poly-A enrichment using the NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB catalog number E7490). NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (catalog number E7760L ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were then incubated overnight at 37 °C in Hybridization Buffer (10% Formamide, 10% 20x SSC, 400 µg/ml E. coli tRNA (New England Biolabs), 5% dextran sulfate ...
-
bioRxiv - Biochemistry 2019Quote: ... and ddH2O to bring the volume 10 µL were mixed with 10 µL 2X NEBuilder HiFi DNA Assembly Master mix (New England Biolabs) and incubated at 50 °C for 1 h ...
-
bioRxiv - Biochemistry 2020Quote: ... and ddH2O to bring the volume to 10 μL were mixed with 10 μL 2X NEBuilder HiFi DNA Assembly Master mix (New England Biolabs) and incubated at 50 °C for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μL of 10 μM FISH probes in hybridization buffer (10% dextran sulfate [Sigma], 2mM vanadyl ribonucleoside complexes [#514025, NEB] ...
-
bioRxiv - Molecular Biology 2022Quote: ... MCC libraries were generated by digesting the chromatin in low Ca2+ MNase buffer (10 mM Tris-HCl pH7.5, 10 mM CaCl2) for 1 h at 37°C with MNase (NEB, M0247) added in varied concentrations (17-19 Kunitz U) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 15 μl of 10 mg/ml BSA and 10 μl of 400 U/μl of T4 DNA ligase (NEB, M0202)) and incubated 4h at 16ºC with mixing (800 rpm ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we added 10 ng of template plasmid to 100 μl of a PCR reaction mix that contains 10 μl of 10×ThermoPol buffer (M0267L, NEB), 2.5 μl of Taq DNA polymerase (M0267L ...