Labshake search
Citations for New England Biolabs :
151 - 200 of 1831 citations for 8 10 Heneicosadiynoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... To digest sialic acid: 1.5μL of a2-3,6,8 Neuraminidase (50U/mL, New England Biolabs, NEB) with 1x GlycoBuffer 1 (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... separated by the SIM sequence (amino acids 469-478) going outwards using Q5 polymerase (NEB). PCR product was purified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and purified the rest of the digestion product with Monarch Nucleic Acid Purification Kit (NEB). We quantified the amount of purified DNA using the Qubit dsDNA HS Assay (Thermofisher ...
-
bioRxiv - Genomics 2024Quote: ... the reverse crosslinked nucleic acids were purified with Monarch RNA purification kit (NEB, 76307-460) and eluted into 21 µL of nuclease free water ...
-
bioRxiv - Microbiology 2024Quote: ... 200 ng of nucleic acids from each complex were mixed in 1xDNase I buffer (NEB) with either RNase-free DNase I (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 units Esp3I (NEB), 800 units T4 DNA ligase (NEB ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnII (NEB), 1X DpnII buffer (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... 10 U DpnI (NEB), 1X CutSmart (NEB) ...
-
bioRxiv - Microbiology 2019Quote: ... coli 10-Beta (NEB) and BL21(DE3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 mM dNTPs (NEB), 10 μM Fwd (5’ GAGGGCCTATTTCCCATGATTC) ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: PCR was performed on toe clippings that were incubated overnight at 55° C in tail lysis buffer (10mM Tris pH 8, 0.4M NaCl, 2mM EDTA, 0.1% SDS, 3.6U/mL Proteinase K (NEB)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 8 μL of the de-phosphorylated DNA was incubated with 2 μL T4 Polynucleotide Kinase (NEB M0203S), 3 μL γ32P-dATP (Perkin Elmer) ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: GBL phosphate (8) was incubated with 5 units of calf intestinal alkaline phosphatase (CIP, New England Biolabs) in 50 mM HEPES buffer (pH 8.0 ...
-
bioRxiv - Microbiology 2021Quote: ... purified RNA (8 μl) was converted into cDNA using a LunaScript RT SuperMix Kit (New England Biolabs) and used as a template in two separate amplification reactions generating odd- and even-numbered tiled amplicons ...
-
bioRxiv - Molecular Biology 2020Quote: ... an additional 32 µL of MyK buffer and 8 µL of Proteinase K (NEB, #P8107S, Ispwich, MA) were added to each tube ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA pellets were resuspended in 5 µL dephosphorylation reaction mix (7 mM Tris pH 8, 1x NEB T4 PNK buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... washed once with media and released for 8 hours with 24 mM dCTP (New England Biolabs # N0441S). 2 mM of thymidine or 0.1 mg/ml of Nocodazole (Millipore-Sigma # SML1665 ...
-
bioRxiv - Molecular Biology 2021Quote: RNA used for RT-PCR was treated with 8 U of DNase I (RNase-free, NEB, M0303) for 15 min at 37 °C in a 50 μl reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 μg of the purified DNA was digested with 8 units of Endo V (New England Biolabs) in a 200 μL reaction at 37 °C for 2 h ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were then loaded onto an 8% polyacrylamide gel alongside a 50 bp ladder (New England Biolabs) and resolved at 100 V for 45 minutes in TBE buffer ...
-
bioRxiv - Genomics 2023Quote: ... Each reverse transcription reaction contained 8 μL template RNA and 2 μL LunaScript RT SuperMix (NEB #E3010). The reaction condition for reverse transcription was ...
-
bioRxiv - Genomics 2023Quote: ... The product was purified with 1.8× Ampure XP beads and eluted in 8 μL elution buffer (NEB). The DNA was denatured by addition of 2 μL 0.1 M freshly diluted NaOH and incubation at 50°C for 10min ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8 PCR cycles for enrichment of adaptor-ligated DNA with unique dual index primer pairs from NEB. The libraries were sequenced on the NovaSeq 6000 system with NovogeneAIT Genomics ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting eluant was further treated with 1% SDS and 8 U/mL proteinase K (NEB, P8107S) at 42°C for 20 minutes then phenol chloroform extracted and ethanol precipitated.
-
bioRxiv - Genomics 2020Quote: ... 2 μL 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, N0446), 10 μL 10x T4 DNA Ligase Reaction Buffer (NEB B0202S) ...
-
bioRxiv - Genetics 2020Quote: ... We digested 10 µg of RCP83 using 10 µL SfiI enzyme (NEB, #R0123S) in 50 µL 10x NEB CutSmart buffer and water to 500 µL ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10 mM 10x Adenosine 5’-Triphosphate (1:10, #P0756S, New England Biolabs). The reaction was incubated in a thermocycler for 37 °C for 30 min ...
-
bioRxiv - Systems Biology 2019Quote: ... To the RNA was then added 10 μl of 10× Capping Buffer (NEB), 5 μl of 10 mM GTP ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dGTP and 10 mM dTTP (stock solutions: NEB, #N0446), 10 μl 10x T4 DNA Ligase Reaction Buffer (NEB #B0202S) ...
-
bioRxiv - Cell Biology 2021Quote: ... To 10 ul of this sample 10 μl of lambda phosphatase buffer (NEB), 10 μl of 10 mM MnCl2 ...
-
bioRxiv - Genomics 2020Quote: DpnI digest: 10 ug genomic DNA + 10 uL CutSmart Buffer (New England Biolabs) + 2 uL DpnI (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each 8-sample pool was then Qbit quantified and amplified using Phusion high-fidelity PCR (New England Biolabs) with a PCR primer with one of three unique barcodes ...
-
bioRxiv - Biochemistry 2019Quote: ... The sample was then further purified by a second affinity step over an 8 mL amylose column (NEB), where it was washed with 3 CV of Amylose Wash Buffer (50 mM Tris pH 7.5 ...
-
bioRxiv - Immunology 2022Quote: ... Final amplification PCR was performed as described before by adding 8 µl of 2 x PCR MM (NEB) with number of cycles according to qPCR (usually Cq values were around 20) ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids coding for segments 2 and 8 were digested using BbsI restriction enzyme (New England Biolab, NEB), the plasmid coding for segment 10 was linearized with BsaI (NEB) ...
-
bioRxiv - Neuroscience 2019Quote: ... excess gel was removed and embedded specimen were placed in digestion buffer (1X TAE, 0.5% Triton X-100, 0.8 M guanide HCL) with 8 units/ml Proteinase K (NEB) for 2 hours at 37 °C ...
-
bioRxiv - Genomics 2019Quote: ... we amplified 20 ng of the library with HSS-pGL4_F and HSS-pGL4_R1 (Supplemental Table 8) using NEBNext High-Fidelity 2X PCR Master Mix (NEB) for 16 cycles ...
-
bioRxiv - Microbiology 2020Quote: ... 8 cycles of PCR amplification were performed using NEBNext® Q5 Polymerase 2X Master Mix (New England Biolabs), according to the manufacturer’s guidelines ...
-
bioRxiv - Biochemistry 2021Quote: ... 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1× NEB 1 buffer ...
-
bioRxiv - Cell Biology 2020Quote: 50 μl of lysed cells were aliquoted to 8 tubes containing 450 μl of digestion mix (1x NEB 1 buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... The final cDNA libraries were amplified (cycle number of 8) using NEBNext Multiplex Oligos for Illumina (NEB, E7335) and purified using SPRIselect size selection beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2022Quote: ... all samples were amplified by a 8-cycle PCR-program using Phusion High-Fidelity DNA Polymerase (NEB #M0530L) using primers 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3’and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’ ...
-
bioRxiv - Genomics 2023Quote: ... the oxidized DNA was purified with 1.8X Ampure XP beads and eluted in 8 μL elution buffer (NEB). The DNA was denatured by adding 2 μL 0.1 M freshly diluted NaOH and incubation at 50°C for 10min ...
-
bioRxiv - Plant Biology 2021Quote: ... Residual primers and nucleic acids were removed from PCR reactions with Exonuclease I (New England BioLabs) and FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... and decapped using Tobacco Acid Pyrophosphatase (TAP) enzyme (Epicentre, can be replaced by RppH from NEB) and purified by phenol/chloroform extraction ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR product was purified using Monarch® Nucleic Acid Purification Kit (New England Biolabs Inc.).
-
bioRxiv - Molecular Biology 2021Quote: ... Customized PURExpress reconstituted systems lacking all amino acids and release factors (Δaa, ΔRF123) (New England Biolabs) (Fig ...
-
bioRxiv - Microbiology 2022Quote: ... aliquots of 200 ng nucleic acid were treated with 2 U DNase I (New England Biolabs), 10 U S1 nuclease (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Genomic deoxyribonucleic acid (gDNA) was extracted using Monarch Genomic DNA Purification Kit (New England BioLabs, T3010S) following procedures for Tissue gDNA isolation ...