Labshake search
Citations for New England Biolabs :
3551 - 3600 of 4045 citations for 7 11 Dimethyldodeca 4 6 10 trien 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... 13.1 μL Murine RNAse inhibitor, 5.25 μL Tartrazine (10 mg/mL, Carl Roth) and 13.2 μL T4 DNA ligase (New England Biolabs). 4 μL of the master mix were added to the Ligation Barcoding Plate #1 or #2 (see above ...
-
bioRxiv - Immunology 2022Quote: ... The nuclease-digested RNA was then dephosphorylated by adding 10 units/µg of Quick CIP enzyme (NEB, M0525) and incubating at 37 °C for 90 min (Kellner et al. ...
-
bioRxiv - Microbiology 2022Quote: ... 1-20 μg of the Env protein was mixed with 1 μl of Glycoprotein Denaturing Buffer (NEB, 10×) and H2O (if necessary ...
-
bioRxiv - Molecular Biology 2023Quote: ... and decapped with 10 U of T4 PNK +/− 40 nmol of ATP and 5 U of RppH (NEB). After each step ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 µl 10x BSA (diluted 1:10 with Milli-Q water from a 100X stock, New England Biolabs), and 1 µl of each enzyme used as described in Fig ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Golden Gate Assembly reactions were performed in a volume of 10 µL with 0.5 µL of either Esp3I (10,000 U/mL, NEB) or BsaI (10,000 U/mL Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1x 10 µl Phusion® High Fidelity PCR master Mix with HF buffer (Biolabs new England M0531S). The thermocycler program was 94 °C for 30 sec ...
-
bioRxiv - Microbiology 2023Quote: ... Each peptide was tested for its ability to be cleaved by recombinant furin (10 U/mL; NEB; P8077) in a buffer of 100 mM HEPES ...
-
bioRxiv - Microbiology 2024Quote: ... 5 μl of 10 mM MnCl2 and 1 μl (400 units) of λPP (New England Biolabs, Ipswich, MA). Untreated lysates received 1 μl of H2O in place of λPP ...
-
bioRxiv - Microbiology 2024Quote: ... 1 mM DTT and 100 μM ATP) and incubated with 10 μM SNAP-Cell TMR-Star dye (NEB) for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were harvested 3 days after electroporation and genomic DNA was extracted with 100 μL lysis buffer (10 mM Tris-HCl, pH 7.5, 0.05% SDS, 25 μg/mL proteinase K (NEB)) at 37 °C with incubation for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... gibco) supplemented with 10% fetal calf serum (eurobio scientific) and 1% ZellShield cell culture contamination preventive (Minerva-Biolabs). Cells were passaged at 80-90% confluency ...
-
bioRxiv - Genomics 2023Quote: ... Purified DNA (∼10 ng) was used to make libraries using the NEBNext Ultra II kit (New England Biolabs) and sequenced on the NextSeq 2000 (Illumina ...
-
bioRxiv - Biophysics 2023Quote: ... the CBP-TEV sites was removed from plasmid pRS306 orc1-gal1-10-orc2 through Gibson assembly (NEB #E2611L) using primers TL-441 ...
-
bioRxiv - Genomics 2023Quote: ... The recombination products were then electroporated into electrocompetent cells (NEB 10-beta, New England BioLabs, cat. No. C3020K) and plated onto Carbenicillin plates ...
-
bioRxiv - Developmental Biology 2023Quote: ... Transcription reaction volume was reduced to 10 µl and 0.5 units of thermostable inorganic pyrophosphatase (New England Biolabs) was included in the reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... BsGrI-HF or AluI individually (10 U/μg DNA in CutSmart® buffer, all from New England BioLabs) overnight at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... (1.33x Gibson-Assembly Master-Mix [for 25 reactions]: 100 μL 5x Isothermal Reaction-Mix, 215.32 μL H2O, 0.2 μL T5 Exonuclease [10 U/μL NEB #M0363] ...
-
bioRxiv - Biochemistry 2023Quote: ... first with 20 pmol membrane impermeable SNAP dye (10 μM SNAP-Surface® 488, New England BioLabs Inc.) followed by 20 pmol membrane permeable SNAP dye (10 μM SNAP-Cell® 647-SiR ...
-
bioRxiv - Biochemistry 2023Quote: ... RNA capping enzyme assays were performed in 10 μL of 1x RNA capping buffer (New England Biolabs, Inc.) containing 0.5 μM substrate RNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA was isolated from 10 hpf embryos using a Monarch total RNA miniprep kit (New England BioLabs Inc.) RNA was stored at −80°C until sample analysis and sequencing by the Molecular Evolution Core at Georgia Tech as previously reported(Johnson et al ...
-
bioRxiv - Systems Biology 2023Quote: ... The concentrated ligated products were then transformed into NEB 10-beta Electrocompetent E.coli (New England Biolabs, Ipswitch, MA). Three transformations were performed to increase the yield ...
-
bioRxiv - Microbiology 2023Quote: ... 10µM of each primer and 10 μl of OneTaq 2X Master Mix with Standard Buffer (New England Biolabs) was used for double-strand DNA synthesis ...
-
bioRxiv - Molecular Biology 2023Quote: ... To a 10 μL aliquot of the supernatant were then added 2 μL of loading dye (NEB, #B7021S) and 1 μL of 2% sodium N-dodecanoylsarcosinate ...
-
bioRxiv - Immunology 2024Quote: ... In brief, isolated Fc domains were denatured (10 minutes, 95C) prior to enzymatic glycan release with PNGaseF (NEB) per manufacturer’s instructions (18 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... 7.5 µl m7G(5′)ppp(5′)G RNA Cap Structure Analog (10 μmol) (New England BioLabs, Ipswich, MA), 2 µg linearized DNA ...
-
bioRxiv - Bioengineering 2024Quote: ... along with a well containing 10 µl Quick-Load® Purple 1 kb DNA Ladder (New England Biolabs catalog no ...
-
bioRxiv - Genetics 2024Quote: ... 0.5 µl of each primer (10 µM) and 12.5 µl Luna Universal Probe qPCR Master Mix (NEB, M3004) were mixed in a final volume of 25 µl ...
-
bioRxiv - Genomics 2024Quote: ... 2 μL of 10% Tween-20 and 5 μL NEBNext High-fidelity 2× PCR Master Mix (NEB, M0541) was added to each well sequentially ...
-
bioRxiv - Cell Biology 2019Quote: ... a linker flanked by AgeI and SacII restriction sites was introduced into pcDNA™4/TO between EcoRI and XhoI restriction sites using Gibson Assembly® (New England Biolabs, Ipswich, MA, USA). The SYFP2 fluorophore was inserted downstream of the linker between SacII and XbaI restriction sites using pSYFP2-C1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 10 μM of the dsAdR adaptor along with 1 μl (400 U) T4 DNA Ligase (New England Biolabs) were added in each ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with 10–14 cycles of enrichment for each sample and using Phusion High-Fidelity Master Mix (NEB catalog #M0531). Samples were submitted for 101 bp paired-end sequencing on an Illumina HiSeq2000 at BGI-Hong Kong ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.5 ng for CTCF and 10 ng for input) were processed using NEBNext ChIP-seq library (New England Biolabs) with manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1µg purified RNA was incubated at 37°C for 30 min with 10 units of T4 PNK (NEB, M0201S) in PNK buffer containing 20 units SUPERase•In in a 25 µl reaction to remove 2′-3′-cyclic phosphates of reporter RNAs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Genomics 2020Quote: ... were combined with RT primer mix [1 μl 250 ng/μl randomhexRT primer and 0.5 μl 10 mM dNTPs (NEB)] ...
-
bioRxiv - Genomics 2020Quote: ... 300 ng of purified genomic DNA was nicked with 10 U of nicking endonuclease Nt.BspQI [New England BioLabs (NEB)] at 37° for 2 hr in buffers BNG3 or BNG2 ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... Reverse transcription was carried out using 10 ng of purified RNA in a reaction with ProtoScript II (NEB M0368S) using 2.0 pmol NI-1032 as a gene-specific primer (Table S1) ...
-
bioRxiv - Genomics 2020Quote: ... 0.5 μL of Ultra II Ligation Module Enhancer and 10 μL of Ultra II Ligation Module master mix (NEB) made up of a total of 20 μL with NFW ...
-
bioRxiv - Microbiology 2020Quote: ... IVT gRNA was produced from SFV infectious clone plasmid and treated with 10 U of DNase1 (RNase-Free; NEB) for 30 min at 37°C before purification with the RNeasy MiniElute Cleanup kit (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... 1 pmol of DNA template was mixed with 10 pmol of oligonucleotide 9 labeled with Yakima Yellow and 1µL of HemoKlen Taq DNA Polymerase (New England Biolabs) in a 6µL reaction mixture containing 50 mM Tris-HCl pH 9.0 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and then permeabilized in ice cold extraction buffer (CSK, 0.1% TX-100 and 10 mM Ribonucleoside Vanadyl Complex (NEB)) for 5 minutes ...
-
bioRxiv - Genomics 2020Quote: Cas9 protein and transcribed sgRNA were incubated for 10 min at room temperature in reaction buffer containing 1× NEB buffer 3.1 (NEB Biolabs) supplemented with 1 mM DTT ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Cloning was done in bacterial strain Escherichia coli NEB® 10-beta (New England Biolabs, Frankfurt a. M., Germany) grown at 37 °C in lysogeny broth [47] supplemented with 60 mg L-1 ampicillin (Applichem ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Purified first-round PCR products were combined with 10 μl NEBNext 2x High-Fidelity Master Mix (New England Biolabs), and 0.3 μM of each barcoding primer containing adapters and indexes to a total volume of 20 μl ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We performed a 10-cycle PCR using a Phusion PCR Kit according to the manufacturer’s protocol (New England Biolabs) with multiplexed primers and adjusted PCR products to 10 μM for sequencing on either an Illumina HiSeq2500 (125 bp paired-end ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were then resupended in 100 µL Ligase Solution (50mM HEPES pH 7.5, 10 mM MgCl2, 1mM rATP (New England Biolabs), 9.5 nM Connector oligomer (TTTCACGACACGACACGATTTAGGTC ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ end of the digested RNA is then labelled with 10 U T4 PNK (New England Biolabs M0201) and 10 µCi [γ-32P]ATP (Perkin Elmer BLU002Z250UC ...
-
bioRxiv - Cell Biology 2021Quote: ... The Pre-hybridization Buffer was replaced with 250 μl of Hybridization Buffer (2x SSC, 10% deionized formamide, 0.1% Tween-20, 2 mM vanadyl ribonucleoside complex (New England Biolabs), 100 μg/mL salmon sperm DNA (Invitrogen) ...