Labshake search
Citations for New England Biolabs :
301 - 350 of 385 citations for n1 Alpha L arabinopyranosylamino guanidine hno3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... A 5 µL aliquot was taken in which primers and dNTPs were then inactivated using Exo-CIP Rapid PCR Cleanup Kit (NEB). From the resulting mixture ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then reverse crosslinked and lysed by adding 10μL of 10X Lysis-T (250mM EDTA, 2M NaCl, 10% Triton X-100) and 4μL of proteinase K (NEB, P8107S) and incubating at 55°C for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... NEBNext Ultra II DNA Library Prep Kit for Illumina with NEBNext Multiplex oligos for Illumina (NEB cat # E7645S/L; E6440) following the instruction manual (V6.1_5/20 ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was diluted to 3ng/µl and 2µl per sample were added to a well containing 10µl Luna Universal Probe qPCR Master Mix (New England Biolabs, M3004), 1.6µl forward/reverse cyp1a primer ...
-
bioRxiv - Cancer Biology 2024Quote: ... perform 25-30 separate 100 µL reactions with 6-8 µg genomic DNA in each reaction using Q5 High-Fidelity DNA Polymerase (New England Biolabs) for around 18-20 cycles and then combine the resulting amplicons ...
-
bioRxiv - Molecular Biology 2024Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was performed using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L) as described for standard RNA-seq (42) ...
-
bioRxiv - Immunology 2024Quote: ... Next the cDNA is put through NEBNext Ultra II Non directional RNA Second Strand Synthesis Module (NEB Cat #E6111S/L). Finally a PCR clean up is done using the PureLink PCR Purification Kit (#K3100-01/02).
-
bioRxiv - Molecular Biology 2024Quote: ... Library preparation was performed using the NEBNext® Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760S/L). The workflow was adapted to generate longer library fragments by reducing the fragmentation time (see manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 20 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 500 nM of each primer CCCTGTGGGTTTTACACTTAAAAAC and CTTCGTCCTTTTCTTGGAAGCGACA (Integrated DNA Technologies) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 µl of unpurified RT product was amplified in 10 µl using Q5 High-Fidelity 2X Master Mix (New England Biolabs) with 1 µM of each primer ...
-
bioRxiv - Genomics 2024Quote: ... PCR that was performed in 60 µl reactions as follows: 20 µl purified library was amplified with 1 µM NEBNext Universal PCR Primer for Illumina (NEB), 1 µM NEBNext Multiplex Oligos for Illumina (Index Primers Sets 1-4) ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 μl of the PCR product was mixed with 1X KLD Reaction Buffer and 1X KLD Enzyme Mix (New England Biolabs). The reaction mix was then used to transform BL21 chemically competent cells ...
-
bioRxiv - Bioengineering 2024Quote: ... Five ligation reactions (20 µL each) were set up using 100 ng DNA (3:1 ratio of library to backbone) and T4 ligase (NEB). Ligation occurred at room temperature for 30 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA pellet was resuspended in 50 μL of TE buffer and 1 μL was used in qPCR reaction with Luna qPCR Master Mix (New England Biolabs).
-
bioRxiv - Genetics 2024Quote: ... concentration ≥ 1 ng/μl) were then subjected to poly(A) enrichment using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). Library preparation was carried out using the NEBNext UltraExpress RNA Library Prep Kit (New England Biolabs) ...
-
bioRxiv - Genetics 2021Quote: ... 1μl XhoI digestion mix consisting of 5U XhoI restriction enzyme and 1 x NEB buffer 2.1 (New England Biolabs, Ipswich, Massachusetts), and 10 ng genomic DNA for iciHHV-6B samples or 200 ng DNA for non-iciHHV-6B samples.
-
bioRxiv - Microbiology 2021Quote: ... A screen for clones containing an insert into pBAD33 was carried out using 1 μl of this suspension as a PCR template using primers oMJD204 and oMJD205 and OneTaq Quickload 2X Master Mix (NEB, #M0486S), according to the manufacturer’s instructions (annealing temperature 45 °C ...
-
A genome-scale CRISPR interference guide library enables comprehensive phenotypic profiling in yeastbioRxiv - Genomics 2020Quote: ... μl of eluted DNA from the previous digestion in 1x final concentration CutSmart buffer with 20 U SphI-HF (NEB R3182S). Digestion was carried out for 1 hour at 37 °C ...
-
bioRxiv - Genetics 2020Quote: ChIP-seq libraries were built using the NEB Next UltraII DNA library Prep kit for Illumina (New England Biolabs #E7645S/L) and Agencourt Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Systems Biology 2022Quote: For INO80 replicate 1 and both input samples 20 μl of the eluted DNA was incubated with 30 μl of end-repair mix (0.66 mM dNTP mix (NEB, cat. # N0447S), 100 U/ml T4 DNA polymerase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 sorted cells were collected into individual wells of 96-well plate containing 5 μl of lysis buffer of NEB Next single-cell low input RNA library prep kit for Illumina (New England Biolabs #E6420). Plates were frozen immediately on dry ice and stored at −80 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... 2.5 µl 25 µM Custom Nextera PCR Primer 2 and 25 µl NEB Next High Fidelity 2x PCR Master Mix (NEB, #M0541) with 1 cycle of (72°C for 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μL of 10x SSS buffer and 1 μL of SSS Enzyme (NEBNext mRNA Second Strand Synthesis Module, New England Biolabs, USA) were added to the 17 μL of the purified sample ...
-
bioRxiv - Genetics 2020Quote: ... PCR amplifications were done in 5 μL volumes in a 384-format PCR plate using Q5® Hot-Start High-Fidelity 2x Master Mix (New England BioLabs, 2.5 μL per reaction for 1x concentration ...
-
bioRxiv - Genetics 2020Quote: ... 1μl of S2R+ or fly genomic DNA was used in a PCR reaction using Q5 High-Fidelity DNA Polymerase (NEB M0491L). Primer pairs (Supplemental File 2 ...
-
bioRxiv - Cell Biology 2020Quote: ... 200 ng/μL was used for subsequent reverse transcription assay with Luna® Universal One Step RT-qPCR kit (E3005, New England Biolabs) according manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Add 50 μl of 10X NEB Buffer 2 and 375 U (15 μl of 25 U/ μl) of MboI restriction enzyme (NEB, R0147), and digest chromatin for 2 hours at 37°C with rotation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and eluted in 10 μL of Ultra Pure™ DNase/RNase free distilled water: the purified amplicon and the low molecular weight DNA ladder (NEB) were run on 2% agarose gel in 1x TBE for 1 h 40 min at 100 V ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Purified DNA was eluted in 30 μl of Ultrapure water and 10ng was inputted into the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645S) using the following PCR programme ...
-
bioRxiv - Immunology 2024Quote: ... Sample preparation was performed according to the protocol “NEBNext Ultra II Directional RNA Library Prep Kit for Illumina” (NEB #E7760S/L). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting products were pre-amplified in a 100 μL reaction using 10 cycles with 4 μL pre-amp primers (10x Genomics PN 20002714) and 50 μL of NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541S). Reactions were cleaned with 1.6X SPRI and eluted in 40 μL EB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Seven µL of DNA product was circularized in a reaction with 1 µL of 10X T4 DNA Ligase Reaction Buffer (NEB, #B0202A), 1 µL T4 Ligase (NEB ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Microbiology 2022Quote: ... Purified RNAs were used for library preparation using the NEB Next Multiplex Small RNA Library Prep kit for Illumina (E7300 L) with Universal miRNA Cloning Linker from Biolabs (S1315S) as the 3’ adaptor and in-house designed indexed primers ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μL of the heated solution was then used as template for PCR using the Q5® High-Fidelity DNA Polymerase (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL was used as input in a second round PCR amplification to attach Illumina adaptors and dual index primers (NEB, E7600S) for five PCR cycles using Q5 HotStart-High-Fidelity 2X Master Mix with an annealing temperature of 65°C for 20 seconds and an extension time of 1 minute ...
-
bioRxiv - Plant Biology 2022Quote: Amplicons were generated from phage display cDNA library of L. japonicus (generous gift from Dr. Jens Stougaard) using Phusion_High-Fidelity DNA Polymerase (NEB, https://www.neb.com/) following the manufacturer’s recommendation ...
-
bioRxiv - Genetics 2023Quote: ... PCR products were analyzed on 2% Agarose gels with 0.5 ng/L Ethidium bromide using a 1kb Plus DNA Ladder (New England BioLabs Cat # N3200S) for size reference ...
-
bioRxiv - Genomics 2024Quote: ... 1 µg of genomic DNA was pooled with 1:20 dilutions of unmethylated lambda (1 µl of 0.1 ng/µl) and methylated pUC19 control DNA (1 ul of 0.005 ng/µl) from the EM-seq kit (E7120L; NEB, Ipswich, MA). Volumes were made up to 50 ul with 0.1x TE buffer (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... and then 5 μL of 10% NP-40 and 10X GlycoBuffer 2 as well as 1 μL of PNGase F (New England Biolabs #P0704S) were added to make a final reaction volume of 50 μL ...
-
bioRxiv - Genomics 2024Quote: ... 1.2 µl of linker oligonucleotide (Integrated DNA Technologies) were mixed with 2 µl 10x 5’DNA adenylation buffer (New England Biolabs, E2610L), 0.095 mM ATP ...
-
bioRxiv - Cell Biology 2024Quote: ... LacO repeats at 10 kb from the cutting site were introduced by replacing a KANMX cassette integrated at positions 462252-462602 (strain C) or 844554-844952 (strain L) with pEF222 plasmid digested by BglII (BioLabs, R0144). LacI-GFP was introduced by digesting plasmid pEF569 78 with NheI (BioLabs ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cloning and primers designed for the generation of the vector and the insert fragments sharing overlapping were done following Gibson Assembly NEB protocol (NEB #E2611S/L) and SnapGene Software ...
-
bioRxiv - Developmental Biology 2020Quote: ... eluted in 20 μl of water and PCR amplified using 25 μl NEB Next High-Fidelity 2x PCR Master Mix (NEB, #M0541 L), 2.5 μl of P5_BRB primer (5 μM ...
-
bioRxiv - Molecular Biology 2021Quote: The singly nicked pCG09 plasmid was prepared by incubating CsCl purified negatively supercoiled pCG09 (60 μ l of 1X NEB Smart Cut buffer with the nicking endonuclease Nb.BbVCI (NEB, 8.5 units) at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... The sample preparation was performed according to the protocol “NEBNext Ultra II Directional RNA Library Prep Kit for Illumina” (NEB #E7760S/L). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative PCR was performed by transferring 2 μl of the RT mix to the qPCR mix prepared with Luna Universal qPCR Master Mix (M3003, New England Biolabs, MA, USA), according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sample preparation was performed according to the protocol “NEBNext Ultra II Directional RNA Library Prep Kit for Illumina” (NEB #E7760S/L). Briefly ...
-
bioRxiv - Molecular Biology 2020Quote: ... The sample preparation was performed according to the protocol “NEBNext Ultra II Directional RNA Library Prep Kit for Illumina” (NEB #E7760S/L). Briefly ...