Labshake search
Citations for New England Biolabs :
151 - 200 of 385 citations for n1 Alpha L arabinopyranosylamino guanidine hno3 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Following KLD (kinase, ligase, and DpnI) treatment and transformation into NEB 5-alpha F’Iq cells (New England Biolabs), cells were grown as near-lawns on LB-chloramphenicol plates and a miniprep was performed from a resuspension of ~5000 colonies for each library.
-
bioRxiv - Immunology 2020Quote: ... and the assembled plasmid pCO1 was transformed into NEB® 5-alpha competent Escherichia coli (High Efficiency) (NEB) according to manufacturer’s instructions (see Supplementary Figure 1 for plasmid maps) ...
-
bioRxiv - Microbiology 2022Quote: ... Escherichia coli NEB® 5-alpha was used for plasmid assembly and cloning following the manufacturer’s instructions (NEB). Transformed E ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli strain MET961 was constructed by replacing the glgB gene of strain NEB 5-alpha (New England Biolabs) with the glgB::Kan-pWV01repA region from E ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids were transformed in 5’-Alpha or Stable competent bacteria (New England Biolabs, Cat C3040H and Cat C2987H), and extracted using a commercial kit (InvitrogenTM K182002) ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmids were amplified using NEB 5-alpha F′Iq Competent Escherichia coli (High Efficiency) (NEB, Cat# C2992H) and isolated using the PureYield Plasmid Miniprep System (Promega ...
-
bioRxiv - Biochemistry 2021Quote: ... The mixture was incubated at room temperature for 10 min followed by transformation into 5-alpha competent cells (NEB). The E ...
-
bioRxiv - Microbiology 2020Quote: ... 2μL of the resulting mix was transformed into chemically competent Escherichia coli (High efficiency DH5-alpha, New England Biolabs) according to manufacturer’s instructions and cultured for 16 hours on Luria broth (LB ...
-
bioRxiv - Microbiology 2021Quote: ... and npmA F and npmA_R, respectively (Table S5) Assembled vectors (Figs. S4C, S4D) were transformed into NEB 5-alpha (New England Biolabs), selecting for ampicillin and gentamicin resistance ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Each library was split in two and transformed separately into 5-alpha cells (NEB, 3.5uL DNA in 35uL cells). Plasmid library isolation ...
-
bioRxiv - Developmental Biology 2020Quote: ... coli DNA ligase (NEB, #M0205 L), 5 μl of E ...
-
bioRxiv - Developmental Biology 2020Quote: ... coli DNA Polymerase (NEB, #M0209 L), 1 μl of dNTP (0 .2 mM) ...
-
bioRxiv - Bioengineering 2020Quote: ... BsaI-HF v2.0 (NEB R3733S/L), and T7 DNA Ligase with the same cycling conditions as the part vectors.
-
bioRxiv - Molecular Biology 2024Quote: ... 15□l of 2.1 buffer (NEB), 30 units of SSP1 (NEB) ...
-
bioRxiv - Immunology 2024Quote: ... Exonuclease I treatment (NEB M0293 L) was used to remove excess primers ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequencing libraries were generated by Genomescan using the NEBNext Low Input RNA Library Prep Kit from Illumina (New England Biolabs, cat#E6420S/L). In short ...
-
bioRxiv - Genomics 2021Quote: ... The reactions were combined and 2.5 μL of the assembly reaction or a control reaction without amplicon were used to transform NEB5-alpha cells (New England Biolabs) to measure background assembly ...
-
bioRxiv - Biochemistry 2022Quote: ... The following cloning strains were used: NEB Stable (lentiviral and piggybac vectors) and NEB 5-alpha (all other plasmids) (New England Biolabs). For cloning of base editor constructs ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids carrying the dcas9/lacI cassette were recovered and propagated in the NEB 5-alpha F’ Iq strain (New England Biolabs). Cloning and/or propagation of plasmids containing the dcas9/lacI cassette in host E ...
-
bioRxiv - Molecular Biology 2022Quote: ... following the manufacture’s protocol. Plasmids were transformed in DH5-alpha or DH10-beta chemo-competent Escherichia coli (E. coli) cells (New England Biolabs). Transformed bacteria were grown in LB medium supplemented with 50 μg/mL kanamycin or 100 μg/mL carbenicillin ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1 μ L of Protoscript II Reverse Transcriptase (200U/μ L, Catalog No. M0368, New England BioLabs Inc.), 2 μ L of 0.1M dithiothreitol (DTT) ...
-
bioRxiv - Immunology 2021Quote: ... coli DNA ligase (NEB, Cat. #M0205 L), 5 μl of E ...
-
bioRxiv - Immunology 2021Quote: ... coli DNA Polymerase (NEB, Cat. #M0209 L), 1 μl of 10mM dNTP (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... and T7 DNA Ligase (NEB M0318S/L) with the same cycling conditions as the part vectors.
-
bioRxiv - Molecular Biology 2024Quote: ... 1.5□l of 10m/ml BSA (NEB), 15□l of 2.1 buffer (NEB) ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 mM (NEB, cat. no. N0447S/L)
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... or Amylose Resin (NEB, 1 L, USA), that had been prewashed with respective lysis buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli NEB 5-alpha (fhuA2∆(argF-lacZ)U169 phoA glnV44 ϕ 80∆(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17) (New England Biolabs) was used for the initial two-plasmid assay ...
-
bioRxiv - Cancer Biology 2024Quote: ... Purified DNA fragments were cloned into pcDNA3.1 vector and transformed into 5-alpha competent cells (#C2987H, New England Biolabs, Ipswich, MA) and 10 colonies were picked for each cell line ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μl of Universal nuclease (Pierce; 125U/L of culture) and 10 μl of DNaseI (NEB; 20U/L of culture) were added and the mixture allowed to incubate for 10 min at RT ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 l of the DNA was used in a 50 l PCR reaction with the enzyme Q5 polymerase (New England Biolabs) and the primers Cytb-f AGTCCTAGTGTAATGGAAGCand Cytb-r ATCTTCAACGTGTTTAGCACC (annealing temperature 61.5°C) ...
-
bioRxiv - Cell Biology 2022Quote: ... and transformed into competent DH5a E. coli (5-alpha Competent E. coli) following the protocol provided by the company (New England Biolabs, Ipswich, MA). For colony selection ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 uL of the Gibson Assembly reaction mixture was transformed via heat shock into chemically competent NEB 5-alpha cells (NEB, Catalog #C2988J), and cells were incubated on lysogeny broth with 10 μg/mL tetracycline (LB-Tet10 ...
-
bioRxiv - Microbiology 2021Quote: ... The amplicon was cloned into the pTXTL-T7p14-aH plasmid (replacing alpha hemolysin, Daicel Arbor Biosciences, Ann-Arbor, MI) using NcoI-HF and SmaI (New England Biolabs, Ipswitch, MA). The new plasmid construct (pSLP15 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... L: 100 bp DNA Ladder (New England Biolabs). 1 ...
-
bioRxiv - Bioengineering 2023Quote: T4 Polynucleotide Kinase (NEB cat. no. M0201S/L)
-
bioRxiv - Bioengineering 2023Quote: Bsu36I restriction enzyme (NEB cat. no. R0524S/L)
-
bioRxiv - Genetics 2023Quote: ... Index primers set 1 and 2 from the NEBNext Multiplex Oligos for Illumina kit (New England Biolabs, E7335S/L E7500S/L) were incorporated using Herculase II Fusion Polymerase Kit (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Bioengineering 2023Quote: BsaI-HFv2 restriction enzyme (NEB cat. no. R3733S/L)
-
bioRxiv - Genetics 2020Quote: ... 5 μl of Klenow exo- (NEB M0212S/L, 5U/μl) was added ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 1.5 µ l of T4 Polynucleotide Kinase (NEB, M0201L). Following incubation ...
-
bioRxiv - Plant Biology 2022Quote: ... enzyme (MBP-DcATX1C) and S-adenosyl-L-methionine (SAM; NEB) were incubated for 0h ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-L-lactyllysine (pan-Kla, PTM BIOLABS, PTM1401, 1:1000), anti-H3K9la (PTM BIOLABS ...
-
bioRxiv - Bioengineering 2023Quote: SalI restriction enzyme (NEB cat. no. R0138S/T/L/M)
-
bioRxiv - Bioengineering 2023Quote: KpnI-HF restriction enzyme (NEB cat. no. R3142S/L/M)
-
bioRxiv - Bioengineering 2023Quote: T4 DNA Ligase (NEB cat. no. M0202S/T/L/M)
-
bioRxiv - Microbiology 2020Quote: ... or 2 μL of Shortcut RNase III (0.02 L/μL; NEB) were added and incubated for 45 seconds ...