Labshake search
Citations for New England Biolabs :
301 - 350 of 10000+ citations for Rat T Cell Surface Glycoprotein CD3 Gamma Chain CD3G ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The isolated DNA and the initial infectious plasmid were used as DNA template for polymerase chain reaction (PCR) using 30 cycles and the Q5 High Fidelity DNA Polymerase (New England BioLabs) under the recommended conditions by the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped by polymerase chain reaction (PCR) using isopropanol-precipitated genomic DNA as template and OneTaq DNA polymerase (New England Biolabs, (NEB), #M0480 ...
-
bioRxiv - Microbiology 2023Quote: Unique VH and VL domains were cloned into linearized human antibody expression vectors (human IgG1 and kappa light chain) using Gibson assembly (NEB) according to the manufacturer’s directions ...
-
bioRxiv - Neuroscience 2023Quote: ... as wildtype or T205A variant were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity master mix (M0492, New England Biolabs (NEB)) from previous plasmid constructs 16 ...
-
bioRxiv - Bioengineering 2024Quote: Full length heavy and light chains for each antibody were cloned by restriction enzyme digest or Gibson Assembly (New England Biolabs) into pCMVR either individually or with a linker ...
-
bioRxiv - Genetics 2023Quote: ... The presence of infectious rIBV in the allantoic fluid was confirmed by a two-step reverse transcription polymerase chain reaction (RT-PCR) protocol using Protoscript II reverse transcriptase (NEB) and the random primer 5′-GTTTCCCAGTCACGATCNNNNNNNNNNNNNNN-3′ for the RT step and recombinant Taq polymerase (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... The remainder of the adapter sequences were added to the heavy and light chains separately by a two-step PCR reaction with Q5 using the NEBNext index primers (NEB) 98°C for 30s ...
-
bioRxiv - Neuroscience 2024Quote: ... The resulting fragments were amplified using ligation-mediated polymerase chain reaction (LM-PCR) with Q5 Hot Start High-Fidelity 2X Master Mix (NEB) to allow the addition of homology arms necessary for cloning ...
-
bioRxiv - Biochemistry 2023Quote: ... the MsbA gene (from Escherichia coli genomic DNA) was amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (New England Biolabs, NEB) and subcloned into a modified pCDF-1b plasmid (Novagen ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... homology arms flanking the region to be deleted were obtained using polymerase chain reaction (PCR) and cloned into the pExG2-KanR suicide vector using Hi-Fi Assembly (New England Biolabs)70 ...
-
bioRxiv - Genetics 2019Quote: ... for 1 hr at 37°C followed by Exonuclease T (NEB) for 45 min at 24°C to blunt DNA ends before Illumina adapter ligation (Canela et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 µl exonuclease T with 10 µl buffer 4 (NEB) was used in the enzymatic reaction ...
-
bioRxiv - Microbiology 2023Quote: ... mRNA molecules are captured using magnetic Oligo d(T)beads (NEB). Following purification ...
-
bioRxiv - Bioengineering 2023Quote: PstI-HF restriction enzyme (NEB cat. no. R3140S/L/T/M)
-
bioRxiv - Bioengineering 2023Quote: BamHI-HF restriction enzyme (NEB cat. no. R3136S/L/T/M)
-
bioRxiv - Genetics 2024Quote: ... One microliter of oligo d(T)23VN primer (50 μM) (NEB) was added to 200 ng/µL of RNA (170 ng worm RNA + 35 ng yeast RNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixed RNA was depleted of rRNA using the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) and fragmented using NEBNext® Magnesium RNA Fragmentation Module (NEB, cat. no. E6150S) for 5 min ...
-
bioRxiv - Immunology 2020Quote: ... and on the Sprague Dawley (SD) strain (rats) (Hera Biolabs) were obtained from vendor and breed in the Division of Laboratory Animal Resources (DLAR ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid DNA encoding rat HEV was linearized using EcoRI (NEB). Five percent of the reaction was subjected to gel electrophoresis with ethidium bromide staining and visualized with ultraviolet light to verify that linearization had occurred.
-
bioRxiv - Biophysics 2020Quote: ... Fluorescence labelling was done by incubating with 5 nmol SNAP-Surface Alexa Fluor 488 (#S9129S, New England Biolabs) for 1 hour at 4 °C ...
-
bioRxiv - Biophysics 2021Quote: ... The medium was then exchanged for 150 μL 10 nM SNAP-Dy549 (SNAP-Surface 549, New England Biolabs) in complete medium and incubated for a further 5 min ...
-
bioRxiv - Biochemistry 2023Quote: ... first with 20 pmol membrane impermeable SNAP dye (10 μM SNAP-Surface® 488, New England BioLabs Inc.) followed by 20 pmol membrane permeable SNAP dye (10 μM SNAP-Cell® 647-SiR ...
-
bioRxiv - Biophysics 2023Quote: ... Purified SNAP-mTwf1 was incubated with 5x excess of SNAP-surface-549 dye (New England Biolabs, Ipswich, MA) overnight at 4°C ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Neuroscience 2020Quote: Overlapping fragments of the unstable NaV1.1 cassette-3 were amplified in polymerase chain reactions (PCR) using Q5® Hot Start High Fidelity 2x Master mix (New England Biolabs) and the primer pairs listed in Table S1 ...
-
bioRxiv - Biochemistry 2020Quote: ... Novel mutants of Ecm2 were generated using inverse polymerase chain reaction (PCR) with Phusion DNA polymerase (New England Biolabs; Ipswich, MA). All plasmids were confirmed by sequencing.
-
bioRxiv - Microbiology 2021Quote: ... Zip codes were then amplified by polymerase chain reaction (PCR) from 200 ng of DNA template using Phusion ® High-Fidelity (HF) DNA Polymerase (New England Biolabs) in HF Buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... neon-Green and mScarlet, these fragments were amplified by Polymerase Chain Reaction using Phusion® High-Fidelity DNA Polymerase (M0530L, New England Biolabs (NEB)) using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers ...
-
bioRxiv - Bioengineering 2022Quote: ... Genes encoding individual components of biosensors were amplified by polymerase chain reaction (PCR) using Q5® High-Fidelity DNA Polymerase (New England Biolabs). Site-directed mutagenesis was performed by QuikChange lightning mutagenesis kit (Agilent ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The genes of interest were amplified by polymerase chain reaction (PCR) using Q5 high fidelity DNA polymerase (New England BioLabs, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... cDNA was amplified via polymerase chain reaction (PCR) using the proof reading Phusion® high fidelity (HF) polymerase (Phusion) (New England Biolabs). Reactions were heated to 98 0C for 30 s ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Synthetic Biology 2021Quote: minD,minE and FtsA genes were amplified by standard polymerase chain reaction (PCR) amplified using Phusion High-Fidelity DNA polymerase (New England Biolabs, USA) as previously reported24,30 ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: sgDNA template was generated using gene-specific oligonucleotides and constant oligonucleotide by polymerase chain reaction for 30 cycles using Q5 high fidelity polymerase (NEB, USA). PCR product was further purified using Magbio Hiprep PCR cleanup system (Magbiogenomics ...
-
bioRxiv - Biochemistry 2022Quote: The P562del and Exo+THR mutants were generated on the pET23-P2-D12A-THR (Table S1) background through inverse Polymerase Chain Reactions (iPCR) using Q5® High-Fidelity DNA Polymerase (NEB) following the manufacturer’s instructions in 25 μl reactions with primers p2_thumb_loop_R/DEL1 (Table S2 ...
-
bioRxiv - Neuroscience 2023Quote: ... as wildtype or T205A variant were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity master mix (M0492, New England Biolabs (NEB)) from previous plasmid constructs 16 ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped by polymerase chain reaction (PCR) using isopropanol-precipitated genomic DNA as template and OneTaq DNA polymerase (New England Biolabs, (NEB), #M0480 ...
-
bioRxiv - Biochemistry 2023Quote: ... the MsbA gene (from Escherichia coli genomic DNA) was amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (New England Biolabs, NEB) and subcloned into a modified pCDF-1b plasmid (Novagen ...
-
bioRxiv - Genomics 2019Quote: ... which cuts at T/CATGA (both from New England BioLabs, Ipswich, MA). NcoI has 3 cut sites and BspHI has 1 cut site within the transgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... mRNAs were enriched using Oligo d(T)25 Magnetic Beads (NEB S1419S) following manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Messenger RNA selection was performed using NEBNext Oligod(T)25 beads (NEB) incubated at 65 °C for 5 min followed by snap-chilling at 4 °C to denature RNA and facilitate binding of poly(A ...
-
bioRxiv - Biochemistry 2021Quote: ... Yeast surface display plasmid pJYDC1 (Adgene ID: 162458) and pJYDC3 (162460) were cleaved by NdeI and BamHI (NEB, USA) restriction enzymes ...
-
bioRxiv - Developmental Biology 2022Quote: ... dissected wing imaginal discs were incubated for 10 min at 25°C with SNAP-Surface Alexa Fluor 546 (3.3 μM, from NEB), rinsed and incubated for 15 min with SNAP-Surface Block at 13 μM before fixation and immunolabeling ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: INS-1 832/3-SNAP-GLP-1R cells on Thermanox coverslips (Agar Scientific) were labeled with 2 μM SNAP-Surface-biotin (a gift from Dr Ivan Corrêa Jr, New England Biolabs), and 5 μg/ml NaN3-free Alexa Fluor 488 Streptavidin ...
-
bioRxiv - Microbiology 2024Quote: ... the protein eluted from MonoQ 5/50 GL was incubated with 10 μM SNAP-Surface Alexa Fluor 647 (NEB) for 1 hour at 4°C prior to gel filtration.
-
bioRxiv - Physiology 2020Quote: ... Membranes were washed with TBS-T and then incubated with an anti-rabbit horseradish peroxidase conjugated secondary antibody (New England Biolabs, 1:10,000 in 5% skim milk in TBS-T) for 2h ...
-
bioRxiv - Molecular Biology 2020Quote: ... the desired sequences pertaining to the truncated forms of the N protein were subcloned from the synthetic gene using polymerase chain reaction (Phusion polymerase, New England Biolabs, Hertfordshire, UK). All genes were cloned into the modified pet28 vector and gene sequences were confirmed by Sanger Sequencing.
-
bioRxiv - Neuroscience 2022Quote: ... and VL in the vector pCSL3l/pCSL3k (light chain lambda/kappa)41 adapted for Golden Gate Assembly procedure with Esp3I restriction enzyme (New England Biolabs, Frankfurt, Germany). Expi293F cells were cultured at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... The pBSMVγPDS plasmid and all plasmids expressing BSMV γ chain carrying sgRNAs were linearized with BssHII (New England BioLabs, catalog number R0199S). In vitro transcription was performed in 20 µL reaction volume using HiScribe™ T7 High Yield RNA Synthesis Kit (New England BioLabs ...
-
bioRxiv - Immunology 2020Quote: ... The heavy and light chain PCR products were cloned in frame with seamless cloning using the NEBuilder® HiFi DNA Assembly Master Mix (NEB, UK) after linearizing the vectors with KpnI (5’ ...