Labshake search
Citations for New England Biolabs :
251 - 300 of 10000+ citations for Rat T Cell Surface Glycoprotein CD3 Gamma Chain CD3G ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Polymerase chain reaction (PCR) was performed using the Phusion Hot Start Flex 2X Master Mix (New England Biolabs). Reactions were set up according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: Polymerase chain reactions (PCRs) for cloning purposes were performed using the high fidelity Phusion DNA Polymerase (NEB, France). PCR products were purified with the NucleoSpin PCR Clean Up kit (Macherey Nagel ...
-
bioRxiv - Neuroscience 2021Quote: ... Surface biotinylated proteins immobilized on streptavidin agarose beads were denatured in Denaturing Buffer (New England Biolabs) at 100°C for 10 min in accordance with the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: ... Cut14-SNAP was stained with 0.2 μM of SNAP-Surface Alexa Flour 647 (New England BioLabs) in PEM buffer for 15 minutes at 25 °C ...
-
bioRxiv - Systems Biology 2022Quote: ... Snap-EGFR was labeled with 0.5 μM Snap-Surface Alexa647 (New England Biolabs GmbH, Frankfurt, Germany) for at least 60’ ...
-
bioRxiv - Molecular Biology 2021Quote: DNAse-treated RNA with high RIN value was used to deplete ribosomal RNA using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6350) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... ribosomal RNA depletion was carried on the extracted RNA using Nebnext rRNA depletion kit (Human/mouse/rat) (New England BioLabs. In, USA). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... RNA-seq libraries were prepared from RNA samples (150ng) using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB Cat# E7405) in conjunction with NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB Cat# E7765) ...
-
bioRxiv - Biochemistry 2023Quote: ... An mRNA transcript library for Illumina sequencing was created using the NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs, Ipswich, MA). A NextSeq 500 sequencer (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... The other pCMVtag2B vectors containing different truncated versions of rat ITCH (Fig 2F) were generated via Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Cat#E0554S) by circularizing the PCR products amplified with the primers listed in Table S2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... oligo-d(T)25-Magnetic Beads (S14195, New England Biolabs) were used ...
-
bioRxiv - Bioengineering 2023Quote: SalI restriction enzyme (NEB cat. no. R0138S/T/L/M)
-
bioRxiv - Bioengineering 2023Quote: T4 DNA Ligase (NEB cat. no. M0202S/T/L/M)
-
bioRxiv - Synthetic Biology 2021Quote: ... The polymerase chain reaction (PCR) products were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs, MA, USA) with strict accordance to the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2019Quote: ... bovis C9.1 gDNA by polymerase chain reaction (PCR) with Phusion High-Fidelity DNA Polymerase (New England BioLabs; Beverley, MA) using primers EAM6 and EAM18 ...
-
bioRxiv - Synthetic Biology 2021Quote: Sub-parts (modules, Supplemental Table 1) were amplified via high-fidelity polymerase chain reaction (PCR) (New England Biolabs #M0491S) using dsDNA templates and ssDNA primers listed in Supplemental Table 2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the circular fragments were amplified by two rounds of polymerase chain reaction (PCR) with Q5-High Fidelity polymerase (NEB). Both PCR rounds begin with an initial denaturation at 98 °C for 30 s ...
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction or gBlock synthesis (IDT) and assembled using HiFi assembly (New England Biolabs) according to the manufacturer’s instructions as shown in Table 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... The Oxiselect Comet Assay Kit (Cell-Biolabs) was used as a reference for the experiment ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested pCFD6 backbone to generate UAS-t::gRNA-twi4x using the NEBuilder® HiFi DNA Assembly Cloning Kit (New England Biolabs, Cat. No: R5520S), following the instructions provided by the manufacturers.
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted using phenol-chloroform and subjected to ribosomal RNA removal using a NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB, Ipswich, MA). A RNAseq library was prepared by using a NEBNext® Ultra directional RNA library prep kit (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... Purified SNAP-mDia1 was incubated with 5x excess of SNAP-surface-649 dye (New England Biolabs, USA) overnight at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Btk-SNAP was combined with a 1.5x molar excess of SNAP-Surface Alexa488 dye (NEB, Cat# S9129S) and incubated overnight at 4ºC ...
-
bioRxiv - Immunology 2021Quote: ... PCR-product and linearized vector containing the constant part of IgG1 heavy or kappa/lambda light chain sequences respectively were assembled using Gibson cloning with HiFi DNA Assembly Master Mix (NEB). Cloning was considered successful when sequence identity was >99.5% as verified by the cBASE module of BASE software ...
-
bioRxiv - Biochemistry 2019Quote: ... Precipitated proteins were removed by centrifugation at 14000g for 30 min at 4°C and the remaining soluble protein was incubated with enterokinase light chain (NEB) for 16h at room-temperature as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction was performed using a 50 µL master mix consisting of 1x standard Taq buffer (New England Biolabs), LCO1490 primer (0.2 mM) ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were run on 1% Agarose gel and those with correct heavy and light chain bands were then used for Gibson ligation (New England Biolabs), cloning into human IgG expression vectors ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions were performed with 15 μL Phusion® High-Fidelity PCR Master Mix (New England Biolabs, Ipswich, USA), 0.2 μM of forward primer ...
-
bioRxiv - Biochemistry 2020Quote: ... Synthesized first-strand complimentary DNA was used to amplify the heavy-chain variable domains using Q5 high-fidelity DNA polymerase (New England Biolabs) and the described primers (CALL001 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the templates were prepared by polymerase chain reaction (PCR) amplification from corresponding plasmid constructs using Q5 DNA Polymerase Master Mix (NEB). The PCR reaction was worked up using a Qiagen PCR purification kit ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genes were amplified in polymerase chain reactions (PCRs) using oligonucleotides with XhoI and KpnI restriction site overhangs and digested with the respective enzymes (NEB). pcDNA3.1 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... these fragments were amplified by Polymerase Chain Reaction using Phusion® High-Fidelity DNA Polymerase (M0530L, New England Biolabs (NEB)) using 35 cycles with an annealing temperature of 60 °C (see table 2 for list of primers ...
-
bioRxiv - Cell Biology 2022Quote: ... The pDyn1 plasmid [the pACEBac1 expression vector containing insect cell codon-optimized dynein heavy chain (DYNC1H1) fused to an amino-terminal His-ZZ-TEV tag and a SNAPf tag (New England Biolabs) on the carboxy-terminus] and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR products were run on 1% Agarose gel and those with correct heavy and light chain bands were then used for Gibson ligation (New England Biolabs), cloning into IgG expression vectors ...
-
bioRxiv - Biochemistry 2020Quote: ... pCSE2.6-hFc-XP or pCSE2.6-mFc-XP 68 where the respective single chain variable fragment of the antibodies or antigens were inserted by NcoI/NotI (NEB Biolabs) digestion ...
-
bioRxiv - Systems Biology 2020Quote: ... Open Reading Frames (ORFs) were amplified by polymerase chain reaction (PCR) from the templates indicated in Table S7 using Phusion DNA polymerase (NEB) with Gateway compatible sequences appended to the end of the primers (5’ sequence - gggg aca act ttg tac aaa aaa gtt ggc acc ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 25–50 ng of template DNA was added to Polymerase Chain Reactions (PCR) containing 1× Standard Taq Buffer (New England Biolabs), 2.5 mm MgCl (New England Biolabs) ...
-
bioRxiv - Biophysics 2019Quote: ... All the p53[R273] point mutations are done using overlap extension polymerase chain reaction by primers which are shown in Table S2 and then digested with Nde1(NEB) & BamH1(NEB ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Tetravalent antibody constructs were generated by fusing these fragments with their respective IgG heavy chain in the pSCSTa mammalian expression vector using Gibson assembly (NEB). Fab-IgG constructs were arranged by fusing a heavy chain Fab domain to the N-terminus of the IgG via a S(G4S)3 linker ...
-
bioRxiv - Synthetic Biology 2020Quote: ... inverted PgolB promoter with Bxb1 recognition sites and reporter-terminator (GFP-rrnBT1) pair were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (M0491, NEB) in thermal cycler (C1000 Touch ...
-
bioRxiv - Microbiology 2021Quote: ... All polymerase chain reactions were performed using 15 μL of Phusion® High-Fidelity PCR Master Mix (New England Biolabs), 0.2 μM of each forward and reverse primer and 10 ng of DNA template ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we performed eight separate polymerase chain reactions for 14 cycles (PCR) using Phusion High-Fidelity PCR Master Mix (NEB Biolabs) and primers that bind to common regions in the adaptors ...
-
bioRxiv - Immunology 2021Quote: The cDNA sequences of the paired variable heavy and light chain region of anti-RBD antibody clones were synthesized as gBlocks (IDT) and cloned by the Gibson assembly (NEB) into human IgG1 heavy chain and light chain expression plasmids ...
-
bioRxiv - Bioengineering 2022Quote: All gene amplifications were performed using polymerase chain reaction (PCR) in a 50 µL mix with Q5 High-Fidelity DNA Polymerase (New England Biolabs) according to the manufactureŕs protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... It was followed by a second In-Fusion HD cloning of a polymerase chain reaction using 5’-GAAGGGGATCCACCGATGGTGAGCAAGGGCGAGG-3’ / 5’-TTAGTAGCTCTAGACTTGTACAGCTCGTCCATGCC-3’ (mScarlet insert) using BamHI and XbaI (New England Biolabs).
-
bioRxiv - Evolutionary Biology 2022Quote: ... We amplified the wild-type EST1 gene from the genome of the haploid strain BY4742 by polymerase chain reaction (PCR) using the high-fidelity Q5 polymerase (NEB) and inserted it into the ΔEST1 cells used in [1] by CRISPR/Cas9 editing ...
-
bioRxiv - Neuroscience 2022Quote: ... The heavy-chain variable domain was then amplified from the cDNA using Q5 high-fidelity DNA polymerase (New England Biolabs) with the described primers (CALL001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... was also reverse-transcribed and Illumina sequencing library prep was followed by 8–10 cycles of polymerase chain reaction (PCR) using High Fidelity Phusion (New England Biolabs). All the libraries were barcoded in the PCR step ...