Labshake search
Citations for New England Biolabs :
301 - 350 of 2646 citations for 7 8 Dihydroisoquinolin 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... 1ng of RNA was added to Luna Universal One-Step qRT-PCR mix (NEB) containing 4μmol of each primer on ice ...
-
bioRxiv - Microbiology 2024Quote: ... the NEB OneTaq® One-Step RT-PCR Kit (New England Biolabs, Product # E5315S) was used to target the haemagglutinin gene ...
-
bioRxiv - Genomics 2024Quote: ... 1 μg of the step one plasmid library was linearized with XhoI (NEB #R0146) at 37°C for 16 hours ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... we used a commercial assay kit (Ph.D.-7 Phage Display Peptide Library Kit, New England Biolabs) and followed the recommended protocol for “solution phase panning with affinity bead capture” with the following modifications ...
-
bioRxiv - Genomics 2019Quote: ... 7 µL of eluate were treated with 0.5 µL exonuclease I (E. coli, New England Biolabs) in 1 x Herculase II reaction buffer (1 h ...
-
bioRxiv - Genomics 2024Quote: ... and pooled into 7 ml ligation buffer (1X ligation buffer 3 (New England Biolabs; without ATP), 1 mM ATP ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Systems Biology 2021Quote: ... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... coli (NEB 5-alpha) were used.
-
bioRxiv - Genetics 2023Quote: ... 5 U StuI (NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB), 250 U T4 DNA ligase in 1X T4 ligase buffer with the remainder nuclease-free water into a 5 µL total reaction ...
-
bioRxiv - Zoology 2023Quote: ... coli (NEB 5-alpha). We injected donor plasmids (20 ng/µl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... coli (NEB 5-alpha) for bacterial transformation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg BSA (NEB), 9 mM DTT ...
-
bioRxiv - Molecular Biology 2023Quote: ... RecBCD (NEB, 5 U), NcoI- HF (NEB ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Cancer Biology 2022Quote: ... The genomic DNA was subjected to a 5-hmC-specific enrichment with EpiMark 5-hmC and 5-mC analysis kit (New England Biolabs, USA). The processed DNA samples were analyzed with qPCR using loci-specific primers (Sf 4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC) with T4 RNA ligase I (NEB). The resultant RNA was reverse-transcribed to cDNA with Superscript III (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’ RNA ligation was performed using 0.5 μl 5’ SR Adapater (NEB-kit) instead of the 5P RNA oligo.
-
bioRxiv - Genomics 2022Quote: ... and followed by a 5′ decapping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S). The 5′ end was phosphorylated using T4 polynucleotide kinase (NEB ...
-
bioRxiv - Neuroscience 2022Quote: ... and the m7G(5’)ppp(5’)G RNA Cap Structure Analog (#S1411, NEB) kits ...
-
bioRxiv - Microbiology 2022Quote: ... with the addition of an m7G(5⍰)ppp(5⍰])G RNA cap (NEB). Transcription was carried out at 42°C for 2 hours (h ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of nuclease-free water and 5 µL of GA mastermix (NEB) were added and incubated at 40°C for a minimum of 1.5 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 mM G(5’)ppp(5’)G RNA Cap Analogue (New England Biolabs), 4 μg DNA ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ligation of 5’ adaptor required (i) Removal of the 5’ cap using RNA 5’ pyrophosphohydrolase (RppH, New England Biolabs, Ipswich, MA, M0356S) (ii ...
-
bioRxiv - Developmental Biology 2021Quote: ... Gene-specific primers were used on cDNA (OneTaq One-Step RT-PCR, New England Biolabs) to evaluate aberrant transcript splicing via gel electrophoresis ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single step PCR was performed using a One-Taq™ PCR reaction kit (NEB, USA) with 30 amplification cycles and 2 ng of original circular-DNA extract as the DNA template ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs, #E3005L or #E3006E) according to manufacturer’s instructions and then analyzed with QuantStudio Design & Analysis Software v1.5.1 (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: The purified aptamer pool was then amplified by PCR with One Taq DNA polymerase (NEB), according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... These filled-in primers are then amplified by PCR with One-Taq DNA polymerase (NEB) and two 21-base primers (HTOP and HBOT ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were run using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a CFX384 (Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... We used the Luna Universal One-step RT-qPCR kit (E3005S, New England Biolabs, MA) to determine the relative abundance of target mRNA between two samples ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was injected into one-cell state embryos together with Cas9 protein (New England Biolabs). Mutant animals were identified by PCR using the primers ...
-
bioRxiv - Immunology 2021Quote: ... and 60 ng were used for the One Taq RT PCR Kit (New England Biolabs) according to the instructions provided by the manufacturer for mRNA quantification and reverse transcription (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using Luna Universal One-Step RT-qPCR kit (NEB, Cat. # E3005E) following manufacturer’s instructions ...
-
bioRxiv - Zoology 2020Quote: One microliter of cDNA was amplified by PCR using OneTaq DNA Polymerase (New England Biolabs) with with the following primers for the two putative SIFamide receptor ...
-
bioRxiv - Genetics 2020Quote: ... One aliquot of the digested DNA was subjected to overnight RNase H (NEB cat#M0297) treatment at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... using Luna Universal Probe One-Step RT-qPCR Kit (New England BioLabs, Ipswich, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... and 16s rRNA transcripts by the Luna Universal One-Step RT-qPCR kit (NEB, E3005), according to the manufacturer’s instructions on an Applied Biosystems 7500 Fast Real-Time PCR System ...
-
bioRxiv - Neuroscience 2022Quote: ... The RT-qPCR was performed using Luna One Step RT-qPCR mix with dUDG (NEB). Amplification using Luna One Step qPCR mix with UDG (NEB ...
-
Circularization of rv0678 for genotypic bedaquiline resistance testing of Mycobacterium tuberculosisbioRxiv - Molecular Biology 2022Quote: One hundred nanograms of the amplicon was incubated with 10U of TelN Protelomerase (NEB, USA) according to the manufacturer’s instructions at 30°C for 30 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR was performed using a Luna ® Universal One-Step RT-qPCR kit (NEB) in a CFX96 qPCR thermocycler (BioRad) ...
-
bioRxiv - Biochemistry 2023Quote: ... For assessment of HAC1spliced mRNA the Luna Universal Probe One-Step RT-qPCR Kit (NEB) was used with 2 µl of a 50 ng/ µl RNA sample ...