Labshake search
Citations for New England Biolabs :
251 - 300 of 2646 citations for 7 8 Dihydroisoquinolin 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... One microgram of RNA was ribodepleted using NEBNext rRNA Depletion Kit (NEB #E6310). Ribodepleted RNA was fragmented ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Luna Universal Probe One-Step RT-qPCR Kit (Cat. No. E3006S, NEB) was used as the relevant master mix ...
-
bioRxiv - Microbiology 2021Quote: ... The RT-qPCRs with Luna Universal One-Step RT-qPCR kit (NEB, USA) were performed according to the protocol of the manufacturer ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR was performed using Luna Universal One-Step RT-qPCR kit (NEB) using the following primers ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... using the Luna® Universal One-Step RT-qPCR Kit (New England Biolabs). mcr-1 and trfA (reference ...
-
bioRxiv - Plant Biology 2022Quote: ... and introduced into the pJL89 vector by one-step NEBuilder Hifi assembly (NEB) (Figure 1a) ...
-
bioRxiv - Microbiology 2022Quote: ... the NEB Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) was used and the qPCR was conducted on the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific)44 ...
-
bioRxiv - Microbiology 2023Quote: ... The Luna Universal One-Step RT-qPCR Kit (New England Biolabs, Ipswich, MA) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... For these analyses Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a CFX opus real-time 384 system (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... Luna Universal Probe One-Step RT-PCR kit (New England BioLabs, Ipswich, Mass) was used for target amplification ...
-
bioRxiv - Bioengineering 2023Quote: The Luna Universal Probe One-Step RT-qPCR kit (New England Biolabs, USA) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... the One Taq HS QuickLoad PCR reagent was used (Catalog no. M0488L, NEB). The genotyping process utilized the primer sets and cycling conditions listed in Supplementary Table 1.
-
bioRxiv - Immunology 2024Quote: One µg of SQBs was incubated with 1.0 U/µL DNase I (NEB) with 10 × DNase I buffer diluted in water (New England Biolabs #M0303S) ...
-
bioRxiv - Genetics 2021Quote: ... 7 μg of ligated chromatin was digested with 10U specific second cutter NlaIII (R0125S, NEB) in 100 μl system with CutSmart Buffer (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: ... 7 μL of the processing reaction products were treated with 10 units Quick CIP (NEB) in 1X CutSmart buffer (NEB ...
-
bioRxiv - Cell Biology 2022Quote: SLC25A46 was amplified through PCR with Taq-polymerase with 7-deaza GTP/nucleotide mix (NEB) using cDNA from control fibroblasts as a template and cloned into Gateway modified pBABE-Puro using Gateway Cloning Technology (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 7 μL of 2x NEBNext Library Quant Master Mix with 1:100 low ROX (NEB), and 1.5 μL ddH2O ...
-
Caspase cleavage of Influenza A virus M2 disrupts M2-LC3 interaction and regulates virion productionbioRxiv - Microbiology 2024Quote: ... Mutant segment 7 plasmids were generated through Q5 Site-Directed Mutagenesis Kit (New England BioLabs).
-
bioRxiv - Molecular Biology 2019Quote: ... The 5′-cap was removed with RNA 5’ Pyrophosphohydrolase (Rpph, NEB), and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Molecular Biology 2021Quote: ... Mpe1 and one of the polymerase module genes were cloned into a SwaI (NEB) digested pBig1a vector of a modified biGBac system (Hill et al. ...
-
bioRxiv - Genomics 2019Quote: ... at room temperature for one hour and then transformed into NEB10 competent cells (NEB). Plasmids from independent colonies were isolated using a plasmid DNA minikit and Sanger sequenced to identify correctly inserted clones.
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 3 thermocycler ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) in an Applied Biosystems QuantStudio 7 thermo-cycler ...
-
bioRxiv - Systems Biology 2022Quote: ... PCRs were performed using the Luna® Universal One Step RT-qPCR Kit (NEB) in a ThermoFisher Quantstudio 3 instrument ...
-
bioRxiv - Microbiology 2022Quote: ... One reaction of NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB #E7645) was used for 1 μg genomic DNA input ...
-
bioRxiv - Cell Biology 2019Quote: ... one was treated with 400U Lambda protein phosphatase (Lambda PP, New England Biolabs, #P0753S) in 50µl phosphatase assay buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... one of which was incubated with 1 µl nicking enzyme (10 units Nt.BspQI (NEB) or 5 units Nb.Bpu101 (ThermoFisher) ...
-
bioRxiv - Plant Biology 2020Quote: ... One microgram of total RNA was then treated with DNase I (New England Biolabs) prior to the first-strand cDNA synthesis using AffinityScript RT-qPCR cDNA synthesis kit (Agilent Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... and 1µl cDNA in 25µL reactions with One Taq DNA polymerase (New England Biolabs). Amplicons were examined under UV light on 1% agarose gels stained with ethidium bromide ...
-
bioRxiv - Genomics 2022Quote: ... samples were diluted one in two before adding 4,000 U T4 DNA ligase (NEB) for overnight incubation at 16°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... sgRNAs were cloned into an all-in-one CRISPR/Cas9 vector using BbsI (NEB). The all-in-one CRISPR/Cas9 vector was cloned between AAV serotype 2 ITRs including a human U6 promoter ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was performed using Luna Universal One-Step RT-qPCR reagents (NEB, E3005) and the primers listed in Table S3.
-
bioRxiv - Plant Biology 2023Quote: ... The Luna® Universal One-Step RT-qPCR Kit (New England Biolabs, Cat # E3005X) and reaction protocol (cycle variations ...
-
bioRxiv - Genetics 2023Quote: ... Reactions were performed using the Luna Universal One-Step RT-qPCR Kit (NEB, E3005L) and a CFX Opus 384 Real-Time PCR System (Bio-Rad).
-
bioRxiv - Biochemistry 2023Quote: ... both the Luna Probe One-Step RT-qPCR 4X Mix with UDG (NEB M3019) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB E3006 ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR was performed with Luna Universal One-Step RT-qPCR Kit from NEB on BioRad CFX96 Touch Real-Time PCR Detection System ...
-
bioRxiv - Genomics 2024Quote: ... 1 μg of the step one plasmid library was linearized with XhoI (NEB #R0146) at 37°C for 16 hours ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1ng of RNA was added to Luna Universal One-Step qRT-PCR mix (NEB) containing 4μmol of each primer on ice ...
-
bioRxiv - Microbiology 2024Quote: ... the NEB OneTaq® One-Step RT-PCR Kit (New England Biolabs, Product # E5315S) was used to target the haemagglutinin gene ...
-
bioRxiv - Biochemistry 2020Quote: ... then extended and inserted into pCS2+8 or pET28a linearized with EcoRI (NEB). All inserts were fully sequenced by Sanger sequencing at the Cornell Genomics Core Facility.
-
bioRxiv - Biochemistry 2019Quote: ... Peak fractions were pooled and passed over an 8 mL amylose column (NEB), washed with 5 CV of Amylose Wash Buffer (50 mM HEPES pH 7.5 ...