Labshake search
Citations for New England Biolabs :
451 - 500 of 2646 citations for 7 8 Dihydroisoquinolin 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... 8 U of Bst DNA polymerase (large fragment; New England Biolabs Inc., Beverly, MA, USA), 1x of the supplied buffer and a variable amount of DNA template ...
-
bioRxiv - Molecular Biology 2021Quote: ... then immediately mixed with 8 μL NEBNext Second Strand Synthesis Reaction Buffer (New England Biolabs), 4 μL NEBNext Second Strand Synthesis Enzyme Mix (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... Truncated ric-8 constructs were generated by PCR using high-fidelity Phusion DNA polymerase (NEB). Phosphorylation mutants were created using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: Infection in HCT116: Cells were infected with virus and 8 μg/mL polybrene (NEB, #H9268).
-
bioRxiv - Biochemistry 2023Quote: ... Desalted peptides were dissolved in 1 ml 1 × CutSmart buffer (pH 8, New England BioLabs) and incubated with 50 units of alkaline phosphatase (calf intestinal ...
-
bioRxiv - Microbiology 2023Quote: ... For the ligation reaction 8 µL of the digest was treated with T4 Ligase (NEB) for 16 hours at 16 °C ...
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Molecular Biology 2022Quote: ... Unligated linkers were depleted by using 5 U per sample of 5’ deadenylase (NEB, #M0331S) and RecJ exonuclease (Biosearch Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L). Post-transcriptional polyadenylation was performed using E ...
-
bioRxiv - Developmental Biology 2021Quote: ... and PCR addition of indices (7-11 cycles) was done using NEBNext Ultra II DNA library prep kit (NEB). Biotinylated capture probes 70 nt in length were designed against every DpnII restriction fragment in a 2.5 Mb window centered on Runx1 (chr16:91,566,000-94,101,999) ...
-
bioRxiv - Cell Biology 2021Quote: ... Clarified lysates were incubated with 0.9 mM MnCl2 and 7 U/μl lysate lambda protein phosphatase (λPP; New England BioLabs), or 0.9 mM MnCl2 and H2O as control ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA of RIN (RNA integrity number) more than 7 is subject to NEBNext Small RNA library kit (NEB). After final PCR amplification with indexed-adaptors ...
-
bioRxiv - Molecular Biology 2021Quote: ... The Taq I-digested chromatin was diluted 7-fold to which 10,000 cohesive end units of Quick T4 DNA ligase (New England Biolabs) were added ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were generated by 7 rounds of PCR amplification using NEBNext High-Fidelity 2X PCR Master Mix (NEB, M0541L), purified using SPRIselect reagent kit (Beckman Coulter ...
-
bioRxiv - Biochemistry 2023Quote: The library was ligated to the barcode oligonucleotide at a 7:1 oligo:library ratio overnight at 16 °C with T4 DNA ligase (New England Biolabs). A no-insert negative control was also ligated overnight using identical conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... asynchronous or mitotic HeLa cell lysates were incubated with 0.9 mM MnCl2 and 7 U/µl λPP (New England Biolabs) or 0.9 mM MnCl2 and water for 1 h at 30 °C.
-
bioRxiv - Cancer Biology 2023Quote: ... the region of interest was minimally amplified through a 7-cycle PCR (Phusion® High-Fidelity DNA Polymerase, NEB) surrounding the mtDNA regions for ddPCR detection ...
-
bioRxiv - Molecular Biology 2023Quote: ... a ratio of 7:1 (oligo:library) was used overnight at 16 °C with T4 DNA ligase (New England Biolabs). The products were purified and eluted in 6 μL water (Zymo Clean and Concentrate) ...
-
bioRxiv - Genomics 2024Quote: ... 30 µL of the eluted DNA samples were mixed with 7 µL of TSO digestion mix (3.5 µL UDG-DNA glycosylase and 3.5 µL UDG Buffer, NEB M0280S) and incubated at 37 ºC for 30 min ...
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence in between the ORFs NCAS0D00680 and NCAS0D00690 was amplified (primers: Ncas_Int618_For 5′-GTTCGCCGGCCTTCCCGCGCTATGAAATTA and Ncas_Int618_Rev 5′-ATCAGGCGCCGAGCATAACCGCTCAAATGC) and inserted between the NaeI and KasI (NEB) restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... the DTB-GTP cap was removed leaving a 5’ monophosphate terminus using RNA 5’pyrophophohydrolase (NEB), RNA was bound to AMPure beads and eluted in low TE (10mM Tris pH8.0 ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence downstream of the ORF NCAS0C00690 was amplified (primers: Ncas_Int696_For: 5′-GGCCGGTACCAATTCATCTAGCAGGATGTAAAATG; Ncas_Int696_Rev: 5′-GAAAGCCGGCGTAGAGCATGCGAGGTTTGG) and inserted between the KpnI and NaeI (NEB) restriction sites in pRS404 (3) ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence upstream of the ORF NCAS0E03540 was amplified (primers: Ncas_Int701_For 5′-ATTCGGATCCTGCAGGCTGTTTGCTGTACT; Ncas_Int701_Rev 5′-GGTGGCGGCCGCGGGGTAACTATCCGCGTCTAA) and inserted between the BamHI and NotI (NEB) restriction sites in pRS402 (5) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Genomics 2020Quote: ... One microgram of the sonicated DNA was incubated in 1x T4 DNA ligase buffer (NEB; Ipswich, MA) with components ...
-
bioRxiv - Microbiology 2019Quote: ... we performed q-RT PCR using the Luna Universal One-Step RT-qPCR Kit from NEB (E3005), using the Applied BiosystemsΤΜ 7500 Real-Time PCR system ...
-
bioRxiv - Synthetic Biology 2019Quote: ... All Gibson reactions were performed at 50 °C for one hour with T5 exonuclease (New England Biolabs), Phusion polymerase and Taq ligase (New England Biolabs) ...
-
bioRxiv - Microbiology 2019Quote: ... RT-PCR was performed in a 50 µl reaction mixture with One Taq 2x master mix (NEB), 20 ng of cDNA and 0.2 µM of each primer (Sigma) ...
-
bioRxiv - Genomics 2021Quote: One reaction of NEBNext® Ultra™ II DNA Library Prep Kit for Illumina® (NEB #E7645) was used for 1 μg of input DNA ...
-
bioRxiv - Biochemistry 2020Quote: ... One microgram of total RNA was reverse transcribed into cDNA with Protoscript II (New England Biolabs, M0368L) followed by qPCR with SYBR Green Master Mix (Bio-Rad ...
-
bioRxiv - Biochemistry 2022Quote: ... The amplified PCR product was digested in one step using NdeI and BamHI HF (New England Biolabs) and ligated into similarly treated pET-15b to create plasmid pET15b-EcGhrA ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was performed using Luna® Universal One-Step RT-qPCR kit (New England Biolabs; #E3005L). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... One μg of RNA was used to prepare cDNA using the LunaScript RT SuperMix (New England Biolabs). cDNA was then diluted 10-fold and 1 μL was used per qRT-PCR reaction ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and IFIH1 were quantified using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs #E3005L) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Enzymes for the one-step isothermal assembly were purchased from New England BioLabs (NEB, Ipswich, MA, USA). PCR were performed using Q5 PCR master mix and One-Taq quick load master mix for colony PCR (NEB) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Enzymes for the one-step isothermal assembly were purchased from New England BioLabs (NEB, Ipswich, MA, USA). PCR were performed using Q5 PCR master mix and One-Taq quick load master mix for colony PCR (NEB) ...
-
bioRxiv - Plant Biology 2020Quote: ... The one-step cDNA synthesis was carried out using LunaScript™ RT SuperMix Kit (NEB Biolabs, USA) followed by qRT-PCR master mix preparation using Luna® Universal qPCR Master Mix (NEB Biolabs ...
-
bioRxiv - Plant Biology 2020Quote: ... The one-step cDNA synthesis was carried out using LunaScript™ RT SuperMix Kit (NEB Biolabs, USA) followed by qRT-PCR master mix preparation using Luna® Universal qPCR Master Mix (NEB Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... one PCR product amplified from gBlock1 (JEP1862+JEP1863) and pMS26 digested with NotI using NEBuilder Hifi (NEB). pMTP114 was constructed by assembling two PCR products amplified from F plasmid (JEP1398+1340 and JEP1341+1399 ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... and selection cassette (either NeoR or HygroR) were assembled in one reaction using NEBuilder HiFi kit (NEB) in pMK289 backbone [3] ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using the Luna universal one-step RT-qPCR kit (#E3005, New England Biolabs) according to the provided protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 12.5 µl of One Taq Quick-load 2x master mix with standard buffer (New England BioLabs, UK) was aliquoted into a DNase-free 0.2ml transparent PCR tube ...