Labshake search
Citations for New England Biolabs :
3101 - 3150 of 3340 citations for 7 Decyn 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... pCS2-dKif6 (1-501)-EGFP was generated from the pCS2-dKif6-EGFP plasmid by Gibson assembly (NEB HiFi DNA Assembly Kit) using a GeneArt gene fragment encoding amino acids 1-501 (Thermo Fisher).
-
bioRxiv - Cancer Biology 2022Quote: ... The pLentiCRISPRv2 plasmid was digested for 1 hr at 55°C with 1U per μg of DNA BsmBI-v2 (NEB, R0580), in 5 μl Buffer 3.1 and to a final volume of 50 μl ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: Purified DNA was amplified with human-or mouse-specific primers covering the RBM20 RS-domain mutation hotspot with Nextera-compatible adapters (Sup. Table 1) using Q5®Hot Start High-Fidelity 2X Master Mix (NEB). One microliter of a 1:100 dilution was used for a second PCR attaching sample-specific index barcodes (Nextera XT Index Kit v2 Set A ...
-
bioRxiv - Developmental Biology 2023Quote: ... was combined with either MEP-1 or Mi-2 PCR-amplified coding sequences in a Gibson assembly reaction using NEBuilder® HiFi DNA Assembly kit (NEB) following manufacturers protocols ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated at 37°C for 20 min followed by dephosphorylation with 1 U Shrimp Alkaline Phosphatase (rSAP, New England Biolabs, #M0371S) and incubation for another 20 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Purified PCR products and the destination vector pSIN-TRE3G-GFP-miRE-PGK-Neo were digested with XhoI/EcoRI 37°C for 1 h and the PCR product was ligated into the destination vector using T4 DNA ligase (NEB, # M0202L) overnight at 16 °C.
-
bioRxiv - Cancer Biology 2023Quote: ... These products were then purified by separation on a 1.0% agarose gel at 100 volts constant for 1 hour and were then purified via the Monarch DNA gel extraction kit (NEB, #T1020L). Purified products were quantified with qubit high sensitivity dsDNA kit (Invitrogen ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng of RCA amplicons were treated with T7 endonuclease 5 μL of 10× reaction buffer and 1 μL of T7 endonuclease I (New England Biolabs, M0302S) in a 50 μL reaction volume ...
-
ER mediates spatial regulation of lysosome-endosome interactions via motion switch at junction sitesbioRxiv - Cell Biology 2023Quote: ... The annealed inserts were digested with EcoRI/AgeI for PLKO.1 and BsmBI for LentiCRISPRv2 and ligated using the Quick Ligation Kit (NEB M2200S).
-
bioRxiv - Cell Biology 2023Quote: ... 10 mM MgCl2 and 1 mM DTT) and treated with 0.5 U/mL calf intestinal alkaline phosphatase (New England Biolabs, cat#M0290) in dephosphorylation buffer for 10 minutes at 37 ℃ ...
-
bioRxiv - Developmental Biology 2023Quote: ... the coding sequence of alg-1 was amplified from genomic DNA using PCR and primers 5’- acaaggacgacgacgacaagatggaagaccaatggttgct-3’ and 3’- cagttggaattctacgaatgttaagcaaagtacatgacgttgttggc-5’ and the coding sequence of mKate::3xFLAG was amplified from a plasmid containing mKate::3xFLAG using PCR and primers 5’-cggcatcgacgacgacgacgatggtttccgagttgatcaagg-3’ and 3’- cttgtcgtcgtcgtccttgtagtcgatAtcgtggtccttgtagtcaccgtcgtggtccttgtagtccttacgatgtccgagcttgg-5’ and the vector containing rgef-1p and unc-54 3’UTR was amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mKate::3xFLAG::alg-1 by using Gibson assembly (NEB E2611). To generate a DNA plasmid containing rgef-1p::mKate::3xFLAG::alg-2 ...
-
bioRxiv - Genetics 2023Quote: ... Index primers set 1 and 2 from the NEBNext Multiplex Oligos for Illumina kit (New England Biolabs, E7335S/L E7500S/L) were incorporated using Herculase II Fusion Polymerase Kit (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: One-cell stage zebrafish embryos were injected with 1-2 nl of injection solution containing 300 ng/μl of Cas9 enzyme (NEB# M0646T) and 12.5 ng//μl of sgRNA ...
-
bioRxiv - Immunology 2023Quote: ... The digested and purified inset and vector were ligated at a ratio of 5:1 using T4 DNA ligase (NEB, M0202) overnight at 18°C ...
-
bioRxiv - Bioengineering 2023Quote: ... and mRNA was isolated from ∼1 μg of total RNA using NEB Next Poly (A) mRNA Magnetic Isolation Module (NEB #E7490). RNA-seq libraries were constructed using the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770 ...
-
bioRxiv - Neuroscience 2023Quote: 2 ug of pX552 vector with SapI gRNA insertion site and Cre-dependent transgene was digested with 1:100 SapI enzyme (BioLabs #R0569S) in 1:10 CutSmart Buffer (BioLabs #B6004S ...
-
bioRxiv - Neuroscience 2023Quote: ... a 3′ RNA adapter with a phosphate on its 5’ (5’- /5Phos/r(N:25252525)r(N:25252525)r(N:25252525)rUrGrGrArArUrUrCrUrCrGrGrGrUrGrCrC rArArGrG/3SpC3/-3’) end was ligated to RNA 3’ ends using T4 RNA ligase 1 (NEB, M0437) at 25 °C for 75 min (with gentle agitation every 10 min) ...
-
bioRxiv - Genomics 2023Quote: ... The pellet was resuspended in 90 µL of freshly prepared Micro-C “Master Mix 1” (10 μl 10x T4 DNA Ligase Buffer, 75 μl ddH2O, 5 μl T4 PNK (NEB #M0201L)) ...
-
bioRxiv - Genetics 2023Quote: ... 600 ng linearized plasmid backbone and 48 ng of digested library (molar ratio of 1:3) were ligated with 5 μL (2000 U) of T4 DNA ligase (NEB M0202S) in a 100 μL reaction ...
-
bioRxiv - Developmental Biology 2023Quote: ... was synthesized from 300 ng to 1 μg of total RNA using a NEB ProtoScript II first strand cDNA synthesis kit (NEB, E6560). The sequences of the primers used for RT-PCR are listed in Table S2.
-
bioRxiv - Immunology 2023Quote: Immunoglobulin libraries were generated from 1 μg of RNA using the NEBNext Immune Sequencing Kit (New England Biolabs, Ipswich, Massachusetts, USA) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was diluted to 100 µL with 1X T4 PNK (polynucleotide kinase) buffer and incubated for 30 min with 1 µL T4 PNK (10 U/µL; NEB M0201) to remove 3’ phosphoryl groups ...
-
bioRxiv - Genomics 2023Quote: ... Each tested enhancer sequence was cloned into the corresponding dual-enSERT-1 vector using NotI digestion followed by Gibson assembly methods (NEB, E2611) (Gibson et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.5XSSC in H2O) on a light table for 1 hour and treated with 2 μg/mL Protease K (NEB, Cat PB107S) in PBS containing 0.3% Triton-X for 10 minutes followed by post-fixation in 4% PFA for 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... The C-terminal truncation of murine STING (to include only amino acids 1-339) was accomplished using NEB Q5 High-Fidelity 2X Master Mix (NEB M0492S) per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... the tissue samples were stained using Vizgen’s Cell Boundary Kit (Vizgen, 10400009) and blocked in blocking solution (Vizgen, 20300012) supplemented with a 1:20 dilution of Rnase inhibitor (NEB, M0314L) for one hour ...
-
bioRxiv - Biophysics 2023Quote: ... Trypsin digestion was initiated by adding 1:10 (trypsin to protein, m/m) mass spectrometry grade trypsin (New England Biolabs #P8101S) in 50 mM ammonium bicarbonate ...
-
bioRxiv - Systems Biology 2023Quote: ... four building blocks needed to be prepared: 1) the backbone by digesting pDL00212 with BstEII-HF (New England Biolabs, Ipswitch, MA) and BamHI-HF (New England Biolabs ...
-
bioRxiv - Pathology 2024Quote: Sequencing library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs, MA). cDNA libraries were sequenced by a NovaSeq 6000 (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... embryos were stained with ush Stellaris and lacZ Stellaris probes (Frampton et al., 2022) and nuclei were stained with DAPI (1:1000, NEB 4083). Samples were mounted in ProLong Diamond antifade mountant (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 1 µg of total RNA used for sequencing library construction with NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, USA). Raw FastQ files were mapped using Bbsplit from the Bbtools 39.01 suite against Mm10 and hg38 (31 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Assembly reaction was performed at 1:2 vector: insert ratio using the NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs #E5520) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... Supplementary Table 1) using a modified protocol of the NEBNext Single Cell/Low Input cDNA Synthesis & Amplification Module (New England Biolabs, UK) (Supplementary Methods and Supplementary Table 18 ...
-
bioRxiv - Biophysics 2024Quote: ... The N-glycans of Fc were unified by adding 1 nmol of β1-4 Galactosidase S (New England Biolabs, Tokyo, Japan) per 1 unit of glycan terminus (mixed so that the enzyme solution was 10% of the total reaction solution ...
-
bioRxiv - Cancer Biology 2024Quote: ... the genomic region (∼2000 bp) surrounding the natural start codon on exon 1 was cloned into the pUC19 vector (New England Biolabs, N3041S) by Gibson Assembly ...
-
bioRxiv - Microbiology 2024Quote: ... An enzymatic cleanup was done to remove primer dimers and inactivate nucleotides by directly adding 0.5µL of Antarctic phosphatase and Exonuclease 1 (New England Biolabs, Inc; M0293L, M0289L) and 1.22µL Antarctic phosphatase buffer (1x final concentration ...
-
bioRxiv - Molecular Biology 2024Quote: ... This incubation was repeated with a 1:200 pA-Dam solution (equivalent to nearly 60 Dam units, determined by calibration against Dam enzyme from NEB, #M0222L), followed by two wash steps ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ubl-1::mCherry::pri-mir-58-sensor-mut mutation was introduced into the CMP1 ubl-1::mCherry::pri-mir-58-sensor plasmid using NEB Q5 site directed mutagenesis (New England Biolabs, E0554S) with the primers GGGATGAGATTGTTCAGTACG and TATGGTATTGGACGAAGTG ...
-
bioRxiv - Microbiology 2024Quote: ... N-4005, and N-4004) were used to cap available 3’-terminal ends using terminal transferase (1 µl, 20 units) (NEB #M0315S), TdT reaction buffer (1.5 µl) ...
-
bioRxiv - Molecular Biology 2024Quote: ... A total of 25 μg was then diluted to 100 μL with CP-1 buffer with or without 2 μg/mL proteinase K (New England Biolabs P8107S) and the indicated concentration of digitonin or 2% Triton ...
-
bioRxiv - Biochemistry 2024Quote: ... was added into each ligation mixture by incubation at 30 °C for 1hour followed by adding 1 µL RecJf (NEB, M0264L) for ssDNA digestion at 37°C for 1 hour ...
-
Genetic gradual reduction of OGT activity unveils the essential role of O-GlcNAc in the mouse embryobioRxiv - Developmental Biology 2024Quote: ... with or w/o 500 µM auxin and the same volume of 2x Monarch DNA/RNA Protection Reagent (NEB #T2011-1) was added before snap-freezing and storage at −80°C until RNA extraction.
-
bioRxiv - Microbiology 2024Quote: ... The pBAD33 plasmid harboring the stem structure of rrsH (corresponding to -131∼-102 and +1559∼+1589 relative to +1 of rrsH gene) under T7 promoter was linearized by digestion with XbaI (NEB, R0145).
-
bioRxiv - Microbiology 2024Quote: ... Rp6 was ligated to mono-phosphorylated transcripts at 37°C for 30 min by adding T4 RNA ligase 1 (#M0204, NEB, USA) with the buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4x106 JM8+/+ and Bmal1-/- cells were fixed with formaldehyde 1% and digested overnight at 37°C using 400U of MboI (New England Biolabs, #R0147M). After filling with 50nM biotin-dATP (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... 1 µg of genomic DNA was pooled with 1:20 dilutions of unmethylated lambda (1 µl of 0.1 ng/µl) and methylated pUC19 control DNA (1 ul of 0.005 ng/µl) from the EM-seq kit (E7120L; NEB, Ipswich, MA). Volumes were made up to 50 ul with 0.1x TE buffer (Sigma-Aldrich ...
-
bioRxiv - Zoology 2024Quote: ... PCR products were electrophoresed and visualized on 1% agarose gels and then were cleaned using Exonuclease I and Shrimp alkaline Phosphatase (New England Biolabs Inc.). Both forward and reverse strands were sequenced using BigDye® Terminator v3.1 cycle sequencing kit ...
-
bioRxiv - Plant Biology 2020Quote: ... and DNA templates and primers listed in Additional Table 1 and cloned into pH7WG plasmid linearized with SalI-HF (NEB, Cataog # R3138S) and AscI (NEB ...
-
bioRxiv - Plant Biology 2020Quote: ... The amplification of the GC-rich region (primer 1) was performed with high fidelity Q5 polymerase (New England Biolabs Inc, Ipswich, MA) using the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... using the LTP library preparation kit and employing NEBNext multiplex oligos for Illumina index primer pairs set 1 (New England Biolabs, Ipswich, Massachusetts). Sequencing was performed using a NextSeq 500/550 mid-output v2.5 300 cycle cartridge (Illumina ...