Labshake search
Citations for New England Biolabs :
2801 - 2850 of 3340 citations for 7 Decyn 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and used as a template for barcode amplification in a 1-step PCR with Q5 polymerase with high-GC buffer (NEB). Indexed samples were sequenced on a NextSeq 550 in high-output mode (Donnelly Centre ...
-
bioRxiv - Microbiology 2024Quote: ... The radioactive probe was prepared from 40 pmoles of D072 primer (Table 1) and labeled at the 5’ end with 10 units of T4 polynucleotide kinase (New England Biolabs) and [γ-32P]-ATP (150 μCi) ...
-
bioRxiv - Cell Biology 2024Quote: THP-1 monocytes were harvested and lysed for RNA extraction using the Monarch Total RNA Miniprep kit (New England Biolabs), according to the manufacturer protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... a five-fold molar excess of oligonucleotides bearing either 8-oxo-G or G was mixed with the phage-extracted circular single-stranded DNA in 1=×=Phusion HF Buffer (New England BioLabs). After denaturation at 90=°C for 2=min followed by rapid cooling ...
-
bioRxiv - Biophysics 2024Quote: We assembled mutant libraries by combining the linearized sensor backbone with each oligo subpool at a molar ratio of 1:5 using Golden Gate Assembly Kit (New England Biolabs; 37 ◦C for 5 min and 60 ◦C for 5 min ...
-
bioRxiv - Biochemistry 2024Quote: ... 3’ adapters with 5’-adenylated RNA adapter (see 3’ adapters in table below) were ligated to the recovered small RNAs using Rnl2(1-249)K227Q RNA ligase (M0351, New England Biolabs) according to the manufacturer’s instructions at 4°C overnight with shaking ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated with 200 µM ATP with ot without 1 µl of recombinant PKA catalytic subunit (PKAc; New England Biolabs) in manufacturer-supplied reaction buffer at 30° C for 30min with agitation ...
-
bioRxiv - Cell Biology 2024Quote: ... with primers BA3187/BA3188 and cloned into RSFDuet-1 using BamHI/EcoRI sites with the NEBuilder HiFi DNA Assembly kit (NEB) (Table S1) ...
-
bioRxiv - Cell Biology 2023Quote: ... the KCNJ16 gene was amplified with 1× Q5 Hot Start High-Fidelity master mix (New England Biolabs, Ipswich, United Kingdom), 0.5 μM forward primer (‘5-‘3 CTACCCGCCAGAGCACATTAT ...
-
bioRxiv - Genetics 2024Quote: ... the targeted tars-1 region was amplified by PCR (primer sequences in Supplemental Table 2) using Q5 PCR mix (New England Biolabs). Amplicons were then purified with DNA Clean and Concentrator kits (Zymo Research ...
-
bioRxiv - Developmental Biology 2024Quote: ... Probes were hybridised in FISH hybridization buffer (50% formamide, 20% dextran sulfate, 2X SSC, 1 μg/μL BSA (New England Biolabs), 10 mM vanadyl-ribonucleoside complex ...
-
bioRxiv - Genetics 2024Quote: The ligation reaction was performed in a 1:5 plasmid to insert copy number ratio using T4 DNA ligase (NEB) at 16°C overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... The genomic region around the miossa20 allele was amplified for 35 cycles using 57°C for annealing and identified by restriction enzyme digestion of the wild-type allele with BsaWI for 1 hour (New England BioLabs). The genomic region surrounding the spo11uc73allele was amplified for 35 cycles with an annealing temperature of 57°C and products were resolved without digestion48 ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µL resuspended plaque were used for each PCR in 10 µL scale in the presence of 1 x High Fidelity PCR Master Mix (NEB) and 500 nM NudE.1 fwd and rev screening primer (Supplementary Table 2 ...
-
bioRxiv - Biochemistry 2023Quote: ... 30 ng pT-plasmid either carrying the blasticidin or the puromycin resistance marker and 1 unit HIFI Polymerase (Q5 HF DNA Polymerase, M04915, NEB) and 1× HiFi reaction buffer (05917131103 ...
-
bioRxiv - Biochemistry 2023Quote: ... or targeting a specific sequence within the puromycin resistant cassette (P3 Supplementary Table 2) were mixed with 1 unit HiFi Polymerase (Q5 HF DNA Polymerase, M04915, NEB) and 1× HiFi reaction buffer with MgCl2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... gondii total RNA was ligated to a small RNA oligo (Rumsh, see Table S9) using T4 RNA Ligase 1 (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... Illumina adapters were ligated on at the 3′ end of the complementary strand using 1× TA Ligase Master Mix (NEB). All products were indexed and sequenced on an Illumina MiSeq instrument ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl from the PCR product were circularized using 1 µl T4 DNA ligase and 2 µl ligation buffer 10x (NEB) in a final volume of 20 µl ...
-
bioRxiv - Cancer Biology 2024Quote: ... before ligation to microsatellite expansion adapters containing an EcoRV restriction site (listed in Supplemental Table 1) using the T4 DNA Ligase Kit (NEB) at a 5:1 ratio overnight at 16°C ...
-
bioRxiv - Biophysics 2023Quote: ... The TRAK1 construct was made through assembling His-ZZ-TEV-SNAP tag and TRAK1(1-395) into a pACEBac1 vector via HIFI DNA assembly kit (NEB). All constructs were verified using whole plasmid sequencing from Plasmidsaurus.
-
bioRxiv - Microbiology 2023Quote: ... For the restriction digest 1 µg of genomic DNA from UACa20 and als4112Δ was incubated for 1 hour at 37 °C with the restriction endonuclease BamHI-HF (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were run on a 1% agarose gel and DNA was extracted using Monarch DNA Gel Extraction Kit (New England Biolabs). DNA was sequenced by Sanger sequencing using either the forward or reverse primer ...
-
bioRxiv - Genomics 2023Quote: ... The washed pellet was resuspended in TM2 buffer with 1 mM CaCl2 and 12000 U of MNase (New England Biolabs), incubated at 23°C for 15 minutes and the reactions stopped by addition of 0.5 mM EGTA ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... An insert downstream of aga2 was amplified from pYD2 using primers PK463+PK464 in a 1 ml PCR reaction (Q5 High-Fidelity 2X Master Mix, NEB), DpnI digested for 2 h and SPRI purified ...
-
bioRxiv - Molecular Biology 2023Quote: ... Harvested cells were rinsed with ice-cold PBS and resuspended in lysis buffer with 1% Triton X-100 and 40 U/mL murine (New England Biolabs) for 20 minutes with intermittent tapping on ice ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10ng of purified BbsI linearized UniSAM or BsmBI linearized pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP was ligated with 1 μl of diluted annealed gRNA with 0.5 μl of T4 ligase (New England Biolabs, #M0202L) in a total volume of 10 μl ...
-
bioRxiv - Systems Biology 2023Quote: ... and used as template for the 2nd PCR where Illumina barcodes were added by NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1 and 2) (New England Biolabs). PCR products were purified using AMPure XP beads (BECKMAN COULTER) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of cDNA was used in a 50 μl PCR reaction containing 1 μl of 10 μM PCR primer and 25 μl of 2x LongAmp Taq Master mix (NEB). PCR was performed as shown in Supplementary Protocol ...
-
bioRxiv - Genomics 2022Quote: ... for 2 hours and then crosslinked with p19 siRNA binding protein (1 μg/ml in depc-PBS; New England Biolabs) or anti-N6-methyladenosine (m6A ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μg of purified total RNA was reverse transcribed using the ProtoScript II First Strand cDNA Synthesis Kit (#E6560, NEB) and random hexamer primers to obtain 50ng/μl cDNAs.
-
bioRxiv - Molecular Biology 2023Quote: The starting library strand (50 pmol) and regeneration hairpin (75 pmol) (Supp. Table 1) were combined in a 1X ligation buffer (New England Biolabs (NEB)) ...
-
bioRxiv - Microbiology 2023Quote: ... was constructed by PCR amplification of the mCTX2-PexoT-ZTP-lacZ plasmid using the three GA primer pairs (Table 1) followed by NEBuilder assembly (NEB). The resulting PexoT-ZTP(M4)-lacZ reporter fusion was integrated in the P ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.7 µl of the sample of eluted extension products were included in a 10 µl T4 RNA ligase 2 truncated KQ reaction (1× T4 RNA ligase buffer (NEB), 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The fragments were inserted within the EcoRV site of the Tol1-based transgenesis vector pDon122 (Cosmo Bio, CSR-CT-NU-002-1) using the NEBuilder HiFi DNA Assembly System (New England Biolabs). The Tol1-based transgenic construct (5 ng/µL ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified lysate was applied to Glutathione Sepharose 4B affinity resin (1 ml bed volume per 2 l culture; New England Biolabs), and incubated with rotation for
-
bioRxiv - Microbiology 2023Quote: ... 50 pmol of each RNA were dephosphorylated by incubation for 1 h at 37°C with 25 U of calf intestine alkaline phosphatase (NEB) in a final volume of 50 µL ...
-
bioRxiv - Genomics 2023Quote: ... and washed twice with 2 mL of CLB containing Superase-In and 1% v/v of 20 mg/mL molecular grade BSA (NEB). After the final wash ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL lysate was used as a template for the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 µL of RNA from 4 x 96 well plates was transferred to a 384 well plate with 3 µL of master mix containing 1 µL of a 10 mM stock of dNTPs (NEB Catalog# N0447L ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3′ RNA adaptor (/5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Neuroscience 2023Quote: ... (see the sequence map in Figure 1) was subjected to restriction digestion using two restriction enzymes: XbaI and AccI (New England Biolabs (NEB)) in the cutsmart buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 1-118 and AA 119-356 were amplified from a mixed-stage N2 cDNA library using Phusion DNA polymerase (NEB) with gene-specific primers ...
-
bioRxiv - Plant Biology 2023Quote: ... And 1 µg of the total RNA was reverse transcribed into cDNA using Luna script RT Supermix (New England Biolabs) as per the manufacture’s protocol ...
-
bioRxiv - Pathology 2023Quote: ... cDNA library was generated from total mRNA (1 µg) using NEBNext UltraTM RNA Library Prep Kits for Illumina (New England BioLabs). cDNA libraries were sequenced by NovaSeq 6000 (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1:100 10 mg/mL BSA in distilled water) with 0.75 µL (150 U) micrococcal nuclease enzyme solution (1:10 micrococcal nuclease (NEB, USA) in micrococcal nuclease reaction buffer) ...
-
bioRxiv - Cell Biology 2023Quote: ... To remove RNA secondary structure and anneal the mRNA capture primer 1 μL of tagged random hexamer (100 μM) and 0.5 μL of 10 mM dNTPs (dNTP solution set NEB - N0446S) were added to the sample ...
-
bioRxiv - Biophysics 2023Quote: ... we digested #126-pSC-T7A1reverse-parS with SpeI-HF and BamHI-HF 1 h at 37°C and heat-inactivated for 20 min at 80°C (New England Biolabs). Subsequently we ran the digested fragment on a 1% TAE agarose gel and the desired ∼14 kbp DNA fragment was isolated from an agarose gel using a gel purification kit (Promega ...
-
bioRxiv - Biophysics 2023Quote: ... We added the 5’-phospho group on the synthetic parS fragment by adding a T4 kinase for 30 min at 37°C and heat-inactivated 20 min at 65°C in 1x PNK buffer supplemented with 1 mM ATP (T4 PNK, New England Biolabs). Next ...
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng of Cy5-labeled and biotinylated DNA was incubated with 1 μg of streptavidin (SA, New England Biolabs, #N7021) in 25 μL of binding buffer (10 mM Tris-HCl ...