Labshake search
Citations for New England Biolabs :
251 - 300 of 2381 citations for Recombinant Human GAB1 Protein T7 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... 20 μL T7 DNA ligase reaction buffer (NEB), and 2 μL nuclease-free water then incubating at 37°C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... T7 or SP6 RNA polymerases (New England Biolabs). After staining ...
-
bioRxiv - Bioengineering 2021Quote: ... using BbsI cut sites and T7 ligase (NEB). 1×105 MC38 cells were transfected with gRNA-ligated eSpCas9 plasmids for 48 hours using TransIT-LT1 transfection reagent (Mirus Bio ...
-
bioRxiv - Bioengineering 2020Quote: ... 5U/μl T7 RNA polymerase (New England Biolabs), 1U/μl SUPERase In (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2020Quote: ... 5U/μl T7 RNA polymerase (New England Biolabs), 1U/μl SUPERase In (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: ... T7 Express LysY competent cells from NEB (C3010I) were transformed with plasmid pEcoli-Cov_42 (Supplementary Table S2 ...
-
bioRxiv - Microbiology 2022Quote: ... coli T7 Express competent cells (Dcm-, NEB #C2566) and plated on agar plates with ampicillin selection (100 μg/ml) ...
-
bioRxiv - Cell Biology 2022Quote: ... T7 exonuclease (0.3 U/µL, New England Biolabs) was mixed with the purified dsDNA (60 ng/µL ...
-
bioRxiv - Biochemistry 2022Quote: ... in T7 Express cells (New England BioLabs, MA). Cells were grown at 37°C to OD600 of 0.8 at which time 0.5 mM Isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cancer Biology 2022Quote: ... and T7 DNA Ligase (M0318, New England Biolabs) by PCR ...
-
bioRxiv - Microbiology 2020Quote: ... coli BL21 T7 Express lacIq (New England Biolabs) from the pLIC-trPC-HMA plasmid with an N-terminal hexahistidine-maltose binding protein (HisMBP ...
-
bioRxiv - Microbiology 2019Quote: ... coli BL21 T7 Express cells (New England Biolabs). Fresh transformants were grown in Terrific Broth (TB ...
-
bioRxiv - Developmental Biology 2020Quote: ... T7 or SP6 RNA polymerases (New England Biolabs). After staining ...
-
bioRxiv - Molecular Biology 2020Quote: ... and T7 endonuclease I (M0302S, New England Biolabs).
-
bioRxiv - Biochemistry 2021Quote: ... one colony of T7 Express competent cells (NEB), transformed with a pET-15b plasmid for the expression of microID ...
-
bioRxiv - Genetics 2021Quote: ... An 80 uL T7 ligation reaction (NEB, M0318S) containing 200 ng of digested plasmid and 37.7 ng of library was performed followed by cleanup and electroporation into DH5α electrocompetent cells (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... T7 SHuffle (C3026, E. coli K strain, NEB) and Nico (λDE3 ...
-
bioRxiv - Microbiology 2021Quote: ... T7 Express with LysY and lacIq (C3013, NEB), T7 SHuffle (C3026 ...
-
bioRxiv - Developmental Biology 2023Quote: ... transcribed with T7 polymerase (E2040S, New England Biolabs) and purified using mirVana miRNA isolation kit (AM1560 ...
-
bioRxiv - Cancer Biology 2023Quote: ... coli strain T7 Express Iq (NEB, Cat. # C2833H) was optimized to yield ∼100 mg/L of recombinant ORF1p-His6 (346 aa ...
-
bioRxiv - Biochemistry 2023Quote: ... coli ER2566 cells (New England Biolabs T7 Express) harboring the pFCEX1D plasmid (containing wild-type FsC ...
-
bioRxiv - Molecular Biology 2023Quote: ... HiScribe T7 High Yield RNA Synthesis Kit (NEB) was used for in vitro transcription ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1:300 T7 RNA polymerase mix (NEB) in transcription buffer (30 mM Tris pH 7.5 ...
-
bioRxiv - Genomics 2024Quote: ... and then 2 μl of T7 Endonuclease (NEB) was added ...
-
bioRxiv - Biochemistry 2023Quote: ... coli T7 Express lysY (New England Biolabs, UK) from pET28a/Cas9-Cys (Addgene plasmid # 53261) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 U/μL T7 RNA polymerase (NEB, M0251L), 1 U/μL RNase inhibitor (NEB ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 U µL-1 T7 RNA polymerase (NEB) and 0.2 µg µL-1 template DNA ...
-
bioRxiv - Immunology 2020Quote: ... was inserted into a published oligonucleotide scaffold (Talbot and Amacher, 2014) and injected together with recombinant Cas9 protein (New England Biolabs) into 1-2 cell stage zebrafish (AB strain) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... coli C2523 pMAL-c5X vector and recombinant MUP (rMUP) was made using pMAL Protein Fusion and Purification System (New England Biolabs) using methods similar to prior studies27,36 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The recombinant DBINO domain containing protein (~80kDa) was purified using the amylose affinity column (New England Biolabs, Massachusetts, United States) and detected using the anti-MBP-HRP antibody (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... Purified dsDNA templates were used as templates for T7 transcription reactions using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB) and bio-16-CTP (Trilink ...
-
bioRxiv - Immunology 2019Quote: IVT was performed using the T7 promoter of the pcDNA3.3_NDG plasmid and HiScribe T7 ARCA mRNA kit with tailing (NEB #E2060S, Ipswich, MA). Whole kit was used with 20 ug DNA following manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: mRNA synthesis via in vitro transcription was performed using linearized plasmid DNA using High Scribe T7 Polymerase HiScribe™ T7 High Yield RNA Synthesis Kit (New England Biolabs): 100 mM NTPs ...
-
bioRxiv - Immunology 2020Quote: CAR-encoding mRNA was transcribed from linearized plasmids encoding anti-human CD19 CAR61 and anti-mouse CD19 CAR71 using T7 RNA polymerase (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs). The mRNAs were transcribed to contain the 5′ UTR derived from the human a-globin 5′ leader RNA ...
-
bioRxiv - Microbiology 2021Quote: ... 10 ul of this was then used as an input for T7 polymerase mediated In vitro Transcription (IVT) using the NEB HiScribe T7 High Yield RNA Synthesis Kit (NEB, # E2040S). Briefly ...
-
bioRxiv - Genetics 2020Quote: ... In vitro transcription template was amplified with T7 promoter sequence containing primer and in vitro transcribed using T7 RNA polymerase (NEB, E2040S). The IVT RNAs were capped using Vaccinia virus capping enzyme (Cellscript ...
-
bioRxiv - Plant Biology 2023Quote: ... 500 ng of RCA amplicons were treated with T7 endonuclease 5 μL of 10× reaction buffer and 1 μL of T7 endonuclease I (New England Biolabs, M0302S) in a 50 μL reaction volume ...
-
bioRxiv - Biochemistry 2023Quote: ... XBP1 Part A and Part B were produced by adding a T7 promoter sequence (TAATACGACTCACTATAGGG) and using the HiScribe T7 RNA Synthesis Kit (NEB E2040S). Template DNA was digested by adding DNase I and incubation for 15 min at 37 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Vector DNA was linearized with NheI or MluI and cRNA synthesized in vitro using the SP6 or T7 AmpliCap Max High Yield Message Maker Kit (Cellscript, USA) or HiScribe® T7 ARCA mRNA Kit (New England Biolabs) and stored at −20°C (for frequent use ...
-
bioRxiv - Immunology 2021Quote: ... or Amylose resin (MBP-tagged fragments, New England Biolabs) following the manufacturer’s protocols.
-
bioRxiv - Biophysics 2022Quote: ... 2018) and a C-terminal 6x His tag and cloned into the pET21B vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Biophysics 2022Quote: ... The DNA fragment was amplified by PCR by inserting a C-terminal 6x His tag and cloned into the pETDUET-1 vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Developmental Biology 2021Quote: ... After annealing the complex an equimolar amount was mixed with 1000 ng Cas9 recombinant protein (NEB; final concentration 20 ng/μL) and incubated at RT for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unligated 3’ linker was removed by incubating the samples with the 5’-deadenylase KmHnt3 (see Recombinant protein expression and purification) and RecJ exonuclease (New England Biolabs, M0264S) for 45 min at 37 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Probes for Po-EgfrA were synthesized from a PCR template using universal T7 primers and T7 polymerase (New England Biolabs, MA, USA). RNA probes for Popi-Dfd were synthetized from the plasmid template of Popi-Dfd3’ using T7/T3 RNA polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2022Quote: ENO1-3’UTR and G6PD-CDS IDT PAGE purified oligos (Supplementary Table S6) containing T7 promoter were in vitro transcribed using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB E2040). RNA was purified using TRIzol (ThermoFisher,15596026 ...
-
bioRxiv - Microbiology 2023Quote: ... AvcI RNA was synthesized by in vitro transcription using the T7-AvcI reverse complement DNA template and the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB™). Bio-11-UTP was included during the transcription reaction for Northern blot detection purposes ...
-
bioRxiv - Genetics 2021Quote: ... followed by T7 Endonuclease I Assay (New England Biolabs). 30 PCR cycles were run in all samples ...
-
bioRxiv - Biochemistry 2020Quote: DNA templates were transcribed with T7 RNA polymerase (NEB) at 37 °C for 6 hrs ...
-
bioRxiv - Biophysics 2019Quote: WT EcSSB and T7 DNA polymerase were purchased (NEB). The plasmid encoding WT EcSSB pEAW134 was a gift from Dr ...