Labshake search
Citations for New England Biolabs :
2751 - 2800 of 10000+ citations for Thyroxine T4 ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... and ligated for 4 hours using 2000 U T4 DNA ligase (New England Biolabs, M0202L). Subsequently ...
-
bioRxiv - Cell Biology 2023Quote: ... Sense and antisense oligos were annealed with T4 Polynucleotide Kinase (PNK) (New England Biolabs; #M0201) and ligated with the digested cutting plasmid with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Cell Biology 2023Quote: ... and ligated with the digested cutting plasmid with T4 DNA ligase (New England Biolabs; #M0202). The ligated fragments were transformed into DH5α E ...
-
bioRxiv - Synthetic Biology 2023Quote: ... To prepare the TEV substrate two oligos were annealed using T4 Polynucleotide Kinase (NEB#M0201S) and T4 DNA ligase buffer (NEB#B0202S) ...
-
bioRxiv - Plant Biology 2023Quote: ... The membrane was hybridised with radioactively labelled probes (T4 PNK, M0201, New England Biolabs (NEB)) in Ultrahyb buffer at 35 ᵒC and exposed to a phosphor screen that was scanned using Typhoon scanner (Cytiva).
-
bioRxiv - Biophysics 2023Quote: ... and ligated to the hairpin with short handles with T4 DNA ligase (New English Biolabs) to finish the 537-bp hairpin preparation.
-
bioRxiv - Genomics 2023Quote: Oligos were reconstituted into 100uM and were mixed and phosphorylated using T4 PNK (NEB M0201S) by incubating at 37 °C for 30 minutes ...
-
bioRxiv - Synthetic Biology 2023Quote: All ligases (T3, T4, E.coli, T7, Taq) used during this work were obtained from NEB. Ligations were performed as indicated by the supplier ...
-
bioRxiv - Genomics 2023Quote: ... either NT of EMC2 guide containing inserts were T4 ligated (ensure it is NEB #M0202M) with an insert to vector ratio of 1:2 for a 16 hours at 16C ...
-
bioRxiv - Genomics 2023Quote: ... Ligation was performed for 2h at 37C with 1x T4 Rnl2 Reaction buffer (NEB B0239SVIAL), 1 U/µl T4 Rnl2 (NEB #M0239) ...
-
bioRxiv - Cancer Biology 2023Quote: ... then incubated overnight at 25°C in 100 μl 1x T4 RNA ligase buffer (NEB) containing 40 μl 50% PEG 8000 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... the complementary oligos were phosphorylated using T4 polynucleotide kinase from New England Biolabs (NEB, USA) first and then ligated to pVT36b using Golden Gate Assembly (Engler et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 µL of T4 DNA ligase high-concentration (2,000,000, units/mL, NEB, cat. no. M0202T) was added ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All molecular biology enzymes (BsaI-HFv2, T4 DNA ligase, Q5 polymerase) were supplied by NEB. Synthetic DNA fragments and oligonucleotides were supplied by either IDT or Twist Bioscience ...
-
bioRxiv - Synthetic Biology 2024Quote: Cloning was performed using restriction enzyme digestion and ligation with T4 ligase (New England Biolabs) or Gibson assembly (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified fragments were dephosphorylated at their 3′ ends with T4 polynucleotide kinase (New England Biolabs) at 37 °C for 1 h and ligated to a 3′ adaptor sequence using T4 RNA ligase 2 (truncated K227Q ...
-
bioRxiv - Microbiology 2023Quote: ... The sequencing adaptors were ligated using the NEB Quick T4 DNA Ligase (New England Biolabs) in combination with ligation buffer (LNB ...
-
bioRxiv - Genomics 2023Quote: ... 100uM Oligos were annealed using 10× T4 DNA ligase reaction buffer (New England Biolabs, B0202S), and T4 Polynucleotide Kinase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated for 15 minutes in the presence of concentrated T4 DNA Ligase (NEB-M0202M). Finally the ligated RNA:DNA hybrid was purified using 1X Agencourt RNAClean XP beads ...
-
bioRxiv - Cell Biology 2023Quote: ... was encoded annealed sgRNA constructs using T4 DNA ligase (catalog #: M0202, New England Biolabs, NEB). Constructs were confirmed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... was encoded annealed sgRNA constructs using T4 DNA ligase (catalog #: M0202, New England Biolabs, NEB). Constructs were confirmed by Sanger sequencing ...
-
bioRxiv - Biochemistry 2023Quote: ... Labelled handles were ligated with the central part with T4 DNA Ligase (New England Biolabs) for 15 h at 16°C followed by 1 h at 37°C before heat inactivation ...
-
bioRxiv - Microbiology 2023Quote: ... For the ligation reaction 8 µL of the digest was treated with T4 Ligase (NEB) for 16 hours at 16 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA adaptator was ligated overnight with 2,000 u of T4 DNA ligase (New England Biolabs). Two PCRs were carried out by using nested primers designed on the adaptator and on the paromomycin resistance gene using the Advantage® GC genomic LA polymerase mix (Clontech) ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 ng of GLORI-treated RNA sample was repaired using T4 Polynucleotide Kinase (NEB, #M0201S). Pre-adenylated 3’-adapter and 5’-adapter were sequentially ligated to the RNA using T4 RNA Ligase 2 ...
-
bioRxiv - Microbiology 2024Quote: ... 9.5 µL of tRNA was combined with 2 U/µL of T4 PNK (NEB, M0201S) was well as N-terminally His6-TEV-tagged ATfaRel SAH (final concentration 1 µM ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... NEBuilder HiFi DNA Assembly Master Mix and T4 DNA ligase from New England Biolabs (NEB). We obtained oligonucleotides from Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... and then ligated using 50U of T4 DNA ligase (New England Biolabs, catalog no. M0202L). After reversing the cross-links ...
-
bioRxiv - Cell Biology 2024Quote: ... Annealed oligos were ligated with linearized pX330 at room temperature overnight with T4 ligase (NEB). Ligated products were transformed into DH5α ...
-
bioRxiv - Molecular Biology 2024Quote: ... was cloned downstream the tagBFP combining inverse PCR and blunt end ligation (T4 Ligase NEB). The sequence of circ-HDGFRP3 (exons 2-3-4-5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the ends of the PCR fragments were then phosphorylated using T4 polynucleotide kinase (PNK, NEB) before undergoing ligation using T4 DNA ligase (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 μM forward and reverse oligo pairs were combined with T4 polynucleotide kinase (PNK) (NEB) and 10X T4 ligation buffer (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and then ligated into a pHRA-based vector using T4 DNA ligase (New England Biolabs). The ligation mixture was purified and then transformed into JW0063 by electroporation ...
-
bioRxiv - Microbiology 2024Quote: ... each pair of oligonucleotides was annealed and phosphorylated with T4 PNK (New England Biolabs, # M0201) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... m7G(5′)ppp(5′)G (NEB, #S1404S) and m7G(5′)ppp(5′)A (NEB ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 and 6 and then assembled into pASW vector by NEBuilder Hifi DNA Assembly kit (NEB).
-
bioRxiv - Biophysics 2023Quote: ... Topoisomerase I treated DNA was purified using Monarch PCR & DNA Cleanup Kit (5 μg) (NEB, T1030S) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μl 10 pM/μl and previously adenylated using the 5′ DNA adenylation kit (NEB, E2610S), and 1 μl T4 RNA ligase 2 truncated KQ (NEB M0373L) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The R1R DNA adapter was adenylated by using a 5’ DNA Adenylation kit (New England Biolabs) and then ligated to the 3’ end of the cDNA by using Thermostable 5’ App DNA/RNA Ligase (New England Biolabs ...
-
bioRxiv - Plant Biology 2019Quote: ... and ligated with NOS terminator flanked with PacI site using T4 DNA ligase (New England Biolabs). This NOS terminator flanked with PacI site was amplified with primer set ...
-
An mRNA processing pathway suppresses metastasis by governing translational control from the nucleusbioRxiv - Cancer Biology 2021Quote: ... and pre-adenylated barcoded linkers were ligated to the RPFs using T4 Rnl2(tr) K227Q (NEB). Unligated linkers were removed from the reaction by yeast 5’-deadenylase (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... digested with HindIII and NheI and subsequently cloned into the digested pGJJ045 by T4 Ligase (NEB) standard protocol.
-
bioRxiv - Biophysics 2021Quote: ... The GRB2 mutagenesis plasmid (pGJJ057) was assembled by a ligation reaction (T4 Ligase, New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: ... 1 μL T4 polynucleotide kinase and 1 μL DpnI (New England Biolabs, Cats. #M0201S and R0176S) and incubated at 37°C for 1 hour ...
-
bioRxiv - Cell Biology 2020Quote: ... The annealed oligonucleotide was cloned into the BsaI-digested pDR274 vector using T4 ligase (NEB M0202). Resulting clones were sequenced to verify correctness ...
-
bioRxiv - Developmental Biology 2020Quote: ... were used to ligate overnight with T4 DNA ligase at a high concentration (NEB, cat.: M0202M), and the Uracil-Specific Excision Reagent enzyme (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... and cloned into pMAD (34) using restriction enzymes MluI and BamHI and T4 DNA Ligase (NEB). The insert was designed so that the flag-tag could be removed using NotI and SpeI ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Genomics 2019Quote: ... and ligated to indexed P1 adapters (one index per sample) using concentrated T4 DNA ligase (NEB). Ligated DNA was purified using AMPure XP magnetic beads ...
-
bioRxiv - Genomics 2020Quote: ... 66U/μl truncated T4 ligase 2 and 13U/μl murine RNAse inhibitor (all from NEB, USA)) were added to the aRNA/adapter solution ...