Labshake search
Citations for New England Biolabs :
2651 - 2700 of 9451 citations for Human Zyxin ZYX ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... followed by the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB, E7770). The quality and concentration of libraries were assessed with Bioanalyzer (Agilent ...
-
bioRxiv - Genomics 2022Quote: ... the NEBNext Ultra II DNA library prep kit (New England Biolabs, Ipswich, MA, USA) was used according to protocol ...
-
bioRxiv - Genomics 2023Quote: ... Samples were further quantified by qPCR using NEBNext Library Quant Kit for Illumina (NEB) and then pooled equimolarly based on estimated concentrations ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR was performed with Luna Universal One-Step RT-qPCR Kit from NEB on BioRad CFX96 Touch Real-Time PCR Detection System ...
-
bioRxiv - Genomics 2023Quote: ... before the library was prepared with the NEBNext RNA Library Prep kit (Biolabs, E7540). Samples were sequenced on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Genetics 2023Quote: Libraries were generated using the NEBNext® rRNA Depletion Kit (NEB, cat no. E6310) and UltraTM II Directional RNA Library Prep Kit for Illumina® (NEB ...
-
bioRxiv - Immunology 2023Quote: ... The VHH specific sequence was amplified using PCR (Phusion High Fidelity PCR kit, NEB) and correct overhangs were incorporated ...
-
bioRxiv - Developmental Biology 2023Quote: ... First-strand cDNA was synthesized using a ProtoScript II cDNA first strand kit (NEB) with 1 μg of total RNA ...
-
bioRxiv - Biochemistry 2023Quote: TgTR N147 was mutated to threonine using the Q5 Site-Directed Mutagenesis Kit (NEB) per the manufacture’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Site-directed mutagenesis was performed using the Q5® Site-directed mutagenesis kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... MscS mutants were generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Microbiology 2023Quote: cDNA libraries were prepared using a NEBNext Ultra II RNA Library Prep Kit (NEB). RNA and cDNA quality and quantity were evaluated by performing a Qubit assay with the TapeStation 4200 system (Agilent Technologies) ...
-
bioRxiv - Microbiology 2022Quote: Chosen residues were substituted with alanine using Q5® Site-Directed Mutagenesis Kit (NEB) according to supplier protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... using primers synthesized by IDT and a Q5® Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... and purified using the Monarch® RNA Cleanup Kit (50 μg) (New England Biolabs) according to the adjusted manufacturer’s instructions for the purification of RNA ≥ 15 nt ...
-
bioRxiv - Cell Biology 2023Quote: ... Mutations on eGFP-ATP7B were prepared following Q5 Site-Directed Mutagenesis Kit (NEB #E0554) protocol.
-
bioRxiv - Immunology 2022Quote: ... cleaned and concentrated 20x using the Monarch PCR & DNA Cleanup Kit (5 µg) (NEB). Further cleanup was done with the E-gel imager system (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... IVT products were purified using a Monarch RNA Cleanup Kit (NEB, T2030L, Ipswich, MA) and stored at -80°C.
-
bioRxiv - Systems Biology 2023Quote: ... The tagmentation process was promptly neutralised using the Monarch PCR & DNA Cleanup Kit (NEB). The samples were then eluted in a final volume of 20 μL using the Elution buffer.
-
bioRxiv - Plant Biology 2023Quote: ... desalted using GenepHlow PCR Cleanup Kit (GeneAid) and ligated with T4 DNA ligase (NEB), each step according to manufacturer’s directions ...
-
bioRxiv - Neuroscience 2023Quote: ... Purified gDNA was subsequently processed using the EpiMark 5hmC Analysis kit (NEB, cat# E3317) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Point mutants were generated using a Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: ... and fragments then gel-purified using Monarch® Genomic DNA Purification Kit (NEB: #T3010S). The pBAD33 vector was DpnI (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting cDNA was purified using the NEB Monarch DNA Cleanup Kit (NEB, T1030) and eluted with 10 µl of elution buffer.
-
bioRxiv - Molecular Biology 2023Quote: ChIP-seq libraries were prepared using NEBNext Ultra DNA Library Prep Kit Illumina (NEB) and sequenced on the Illumina HiSeq 2500 platform (PE 50bp) ...
-
bioRxiv - Zoology 2024Quote: ... and pMi{Hau-cif7-ngfp}) were produced using NEBuilder HiFi DNA Assembly kit (NEB). The pMi base plasmid was linearized by double digestion with SpeI and SacII ...
-
bioRxiv - Developmental Biology 2024Quote: ... The gRNAs were synthesized using the HiScribe T7 High Yield RNA Synthesis Kit (NEB) and purified using the Monarch RNA Cleanup Kit (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Minipreps were performed using Monarch Plasmid Miniprep kit (New England Biolabs, Ipswich, Massachusetts, USA) and PCR products were purified with Monarch PCR and DNA Cleanup kit (New England Biolabs ...
-
bioRxiv - Developmental Biology 2024Quote: The mRNA isolation utilized the NEBNext Poly(A) mRNA Magnetic Isolation Kit (NEB, #E7490) with 1 μg of total RNA ...
-
bioRxiv - Developmental Biology 2024Quote: Total RNA was extracted from collected spermatids fractions with Monarch RNA extraction kit (NEB) according to manufacturers’ protocol for RNA extraction from tissue or leukocytes ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Libraries were pooled and sequenced with paired end sequencing on a Novoseq 6000 (Novogene).
-
bioRxiv - Systems Biology 2024Quote: ... PCR products were spin-purified using the Monarch PCR & DNA Cleanup Kit (NEB T1030) or the DNA Clean & Concentrator-5 kit (Zymo Research ...
-
bioRxiv - Synthetic Biology 2024Quote: ... RNA samples were purified using the Monarch® RNA Cleanup Kit (New England Biolabs) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: DNA from positive clones was extracted using a Monarch Genomic DNA Purification kit (NEB). DNA insertion was confirmed by amplification of a fragment including both genomic and kanamycin resistance cassette sequences followed by the sequencing of amplified DNA (Macrogen).
-
bioRxiv - Microbiology 2023Quote: ... RNA was then purified using the Monarch RNA Cleanup Kit (NEB, Cat. No. T2040).
-
bioRxiv - Molecular Biology 2023Quote: ... Sequencing libraries were constructed using NEBNext library kits (New England Biolabs, Ipswich, MA, USA) and sequenced on a NextSeq 550 sequencer (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... Amplicon gel extraction following the Monarch® DNA Gel Extraction Kit (NEB, Frankfurt, Germany) instructions was used to isolate and purify the cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... the IVT products were purified with Monarch RNA purification kits (New England Biolabs, NEB), and the purified RNA was quantified using a nanophotometer (IMPLEN) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the IVT products were purified with Monarch RNA purification kits (New England Biolabs, NEB), and the purified RNA was quantified using a nanophotometer (IMPLEN) ...
-
bioRxiv - Genomics 2023Quote: ... PCR was performed with the Phusion High-Fidelity PCR kit (E0553L, New England BioLabs) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The transcripts were purified with a Monarch RNA Cleanup kit (New England Biolabs, USA). The RNA annealing reaction containing 10 mM Tris-HCl (pH 7.4 at 25°C) ...
-
bioRxiv - Molecular Biology 2023Quote: ... for mRNA enrichment and Ultra II directional RNA Library Prep Kit (NEB, Cat# E7760) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the cDNA libraries were purified using the Monarch PCR & DNA Cleanup Kit (NEB). High-throughput sequencing was performed on an Illumina NextSeq 550 in paired-end mode with 150 cycles per end.
-
bioRxiv - Molecular Biology 2023Quote: ... transferred to 50 μl DNA/RNA protection buffer (Monarch Total RNA Miniprep Kit, NEB), and stored in liquid N2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Sequencing libraries were generated using NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample ...
-
bioRxiv - Neuroscience 2023Quote: ... Ribosomal RNA was depleted from total RNA with the rRNA depletion kit (NEB# E6310) and subsequently prepared for RNA-seq with the NEBNext Ultra Directional RNA Library Prep Kit (NEB #E7420 ...
-
bioRxiv - Biophysics 2023Quote: RNA synthesis was performed according to the HiScribe SP6 RNA Synthesis Kit protocol (NEB). Double-stranded DNA sequences containing SP6 promoter 5′ATTTAGGTGTGACACTATAG 3′ were used as DNA matrixes for RNA transcription.
-
bioRxiv - Bioengineering 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs□ Inc., MA, USA) was preferred ...
-
bioRxiv - Bioengineering 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabs□ Inc., MA, USA) was used ...
-
bioRxiv - Biophysics 2023Quote: ... The NEBuilder HiFi DNA Assembly and Q5 site-directed mutagenesis kits (New England Biolabs) were used for plasmid construction ...