Labshake search
Citations for New England Biolabs :
2551 - 2600 of 9451 citations for Human Zyxin ZYX ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... the linear plasmid was blunted by digestion with Quick Blunting™ Kit (NEB, USA) and ligated to re-circularize the plasmid ...
-
bioRxiv - Microbiology 2024Quote: ... First-strand cDNA was synthesized using ProtoScript II first strand cDNA synthesis kit (NEB), and quantitative real-time PCR was performed on QuantStudio 3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... The 3p-v4 oligo was 5′ adenylated using 5′ DNA Adenylation Kit (E2610S, NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... All amplified fragments were then combined using Gibson assembly (Gibson assembly cloning kit, NEB) with 20 base pair overhangs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... RNA was extracted first using a Monarch® Total RNA Miniprep Kit (NEB T2010) with on-column DNAse digestion ...
-
bioRxiv - Microbiology 2024Quote: Deletion of vpr was achieved using Q5 Site-Directed Mutagenesis kit (New England Biolabs) where the majority of the vpr coding sequence was deleted using PCR exclusion (forward - CAGAATTGGGTGTCGACATAG ...
-
bioRxiv - Bioengineering 2023Quote: ... using the Monarch Genomic DNA Purification Kit following the manufacturer’s protocol (New England Biolabs). The targeted region in NEAT1 was amplified by PCR (primers in Extended Data Table 2) ...
-
bioRxiv - Biophysics 2023Quote: ... The mRNAs were capped using the vaccinia virus capping enzyme kit (New England Biolabs) following the manufacturer’s protocols ...
-
bioRxiv - Synthetic Biology 2023Quote: ... After gel extraction using the Monarch DNA Gel Extraction Kit (New England Biolabs, T1020S) Gibson Assembly (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were prepared with the NEBNext Ultra II Library Prep Kit for Illumina (NEB) and paired-end sequencing was performed using an Illumina Novaseq instrument.
-
bioRxiv - Cell Biology 2023Quote: ... RNAs were selected using the NEB Next Poly A+ Isolation Kit (NEB #E7490S/L). Poly A+ fractions were eluted ...
-
bioRxiv - Cell Biology 2023Quote: ... using the Gibson Assembly Cloning Kit as instructed by the manufacturer (New England BioLabs). The resulting vector was termed pCEP4-MFAP4 coding for the amino acid sequence M1KAL…IRRA255 ...
-
bioRxiv - Cell Biology 2023Quote: ... libraries were prepared using NEBNext Ultra kit (New England Biolabs #E7490, #E7770, #E7335, #E7500) and sequenced using a Nextseq500/550 sequencer ...
-
bioRxiv - Genetics 2023Quote: Sequencing library was constructed by NEBNext ultra II DNA library prep kit (NEB E7103L). 50 million paired-end 50bp reads were obtained for each ChIP and input sample using a NextSeq 2000 instrument ...
-
bioRxiv - Genetics 2023Quote: ... and introduced mutations using a Q5 Site-Directed PCR Mutagenesis Kit (New England Biolabs). After mutagenesis ...
-
bioRxiv - Genetics 2023Quote: ... We performed cDNA synthesis from RNA using LunaScript RT Supermix Kit (New England Biolabs) beginning with 500ng of RNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Library Kit for Illumina (NEB) and sequenced with an Illumina Novaseq 6000 system to produce 50 bp paired-end reads ...
-
bioRxiv - Genetics 2023Quote: ... digested DNA was converted using New England Biolabs’ Enzymatic Methyl-seq Kit (E7120S, NEB) to detect selectively oxidized unmethylated cytosines ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used the NEBNext® UltraTM FS II Library Prep kit (New England Biolabs) with default parameters ...
-
bioRxiv - Genomics 2023Quote: ... We used the NEB Next Enzymatic Methyl-seq Kit (New England Biolabs Cat.no. E7120S). Control DNA (CpG methylated pUC19 and unmethylated lambda ...
-
bioRxiv - Genomics 2023Quote: ... The homology vector was cloned by Gibson assembly (Gibson Assembly Master Mix kit, NEB) into a restriction-enzyme digested pCAG backbone plasmid ...
-
bioRxiv - Microbiology 2023Quote: PCR products were routinely purified using Monarch® PCR & DNA clean-up kit (NEB), or E.Z.N.A.® Cycle Pure Kit (Omega Bio-Tek ...
-
bioRxiv - Genomics 2023Quote: ... followed by NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) and NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 (NEB# E6440) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were quantified using NEBNext® kit for Illumina® (New England Biolabs, E7630S), pooled at equimolar amounts ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting RNA was purified using the Monarch RNA cleanup kit (New England Biolabs) and analyzed by agarose gel electrophoresis.
-
bioRxiv - Biophysics 2024Quote: ... Libraries were prepared using NEBNext ultra II DNA library kit for Illumina (NEB Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Biophysics 2024Quote: ... Libraries were prepared using NEBNext ultra II DNA library kit for Illumina (NEB Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: Protein expression was performed with the PURExpress In Vitro Protein Synthesis kit (E6800, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μg RNA was reverse transcribed to cDNA using LunaScript RT SuperMix Kit (NEB). qPCR was performed in 20 μl reactions containing diluted cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... First-strand cDNA was generated using ProtoScript first strand cDNA synthesis kit (NEB, E6300S) with oligo-dT primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... where ribodepletion was performed using the NEBNext rRNA Depletion Kit (New England BioLabs, E6310). Paired-end 75 base pair (bp ...
-
bioRxiv - Cancer Biology 2023Quote: ... where ribodepletion was performed using the NEBNext rRNA Depletion Kit (New England BioLabs, E6310). Single-end 75 base pair reads were sequenced using the NextSeq 500 (Illumina).
-
bioRxiv - Biochemistry 2022Quote: ... using the Q5 site-directed mutagenesis kit and primer design tools (New England BioLabs) with the following primer pair:
-
bioRxiv - Molecular Biology 2023Quote: ... 50 μg tissue for each sample using the Total RNA isolation kit (#T2010, NEB) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Utilizing the NEBNext® UltraTM RNA Library Prep Kit for Illumina® (NEB, USA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The product was purified with a Monarch PCR and DNA cleanup kit (NEB, T1030) and restricted with enzymes Nde1 (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (E7760S, New England Biolabs) was used to prepare the sequencing libraries ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was extracted using Monarch® Total RNA Miniprep Kits (New England Biolabs) as described by the manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... The transcribed mRNA was purified using Monarch RNA Cleanup Kits (NEB, Cat. No. T2040L) and kept in - 20 until further use.
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was extracted using Monarch® Total RNA Miniprep Kits (New England Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RNA immunoprecipitations and inputs were converted to cDNA using LunaScript RT SuperMix Kit (NEB). m6A-immunoprecipitated samples were normalised to their respective input samples and m6A content at a particular region calculated relative to an unmodified control region within the same transcript.
-
bioRxiv - Genetics 2023Quote: ... followed by in vitro transcription with the T7 High Yield RNA Synthesis kit (NEB). Newly synthesized sgRNAs were purified using the MEGAclear kit (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was isolated from cells using the Monarch Total RNA Miniprep kit (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... The domain swap constructs were assembled using the NEBuilder HiFi DNA assembly kit (NEB). Briefly ...
-
bioRxiv - Microbiology 2022Quote: We introduced single point mutants using the Q5® Site-Directed Mutagenesis kit (NEB). Primers containing the mutation amplified the entire CIp10–GPR1–mTurquoise2 plasmid and were confirmed through sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... Ph.D.™-12 Phage Display Peptide Library Kit (New England BioLabsⓇ Inc., MA, USA) was preferred in order to select aggregation inhibitory peptide selection ...
-
bioRxiv - Microbiology 2023Quote: ... USA] or the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Plasmid assembly was conducted using NEBuilder HiFi DNA Assembly cloning kit (NEB, cat # E5520S) and transformed to DH5α-competent cells ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length PCR product was purified using Monarch Gel Extraction Kit (NEB #T1020), according to manufacturer’s instructions.
-
bioRxiv - Bioengineering 2023Quote: ... and the plasmids were extracted via NEB Monarch Plasmid mini-prep kit (NEB T1010). Plasmid concentrations were measured spectrophotometrically at 260 nm via a Nanodrop 2000 (Thermo Scientific ...