Labshake search
Citations for New England Biolabs :
201 - 215 of 215 citations for Oleoyl Gly Lys m PEG11 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... and 4.5 μM biotinylated primer oligo IF238 (5/Biosg/TC TCC TCC TTC T) were annealed in T4 ligase reaction buffer (NEB B0202S). The mixture was heated to 75°C for 5 min and cooled to 4°C at a rate of −1°C min−1 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μl of the diluted samples was then denatured by addition of 4 M urea and Proteinase K (40 U/ml; New England Biolabs #P8107S), incubated for 5 min at 65°C ...
-
bioRxiv - Plant Biology 2021Quote: ... The pAB-M vector (DNA-Cloning-Service, Hamburg, Germany) was digested with SpeI and Gibson Assembly (NEB, Frankfurt am Main, Germany) was performed according to the manufacturer’s protocol using the beforehand amplified fragments to generate pSI56 ...
-
bioRxiv - Genomics 2023Quote: Nuclei were resuspended in 200 uL of Methylation Reaction Buffer (Buffer M containing 1mM S-adenosylmethionine (SAM)) (New England BioLabs B9003S). 10uL high-concentration EcoGII was added per 1e6 nuclei and the nuclei suspension was incubated at 37°C for 30 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 µM of one of the following indexed reverse primer (aatgatacggcgaccaccgagatctacactcgtggagcgagcacaaaaggaaactcaccctaactgt, aatgatacggcgaccaccgagatctacacctacaagataagcacaaaaggaaactcaccctaactgt, aatgatacggcgaccaccgagatctacactatagtagctagcacaaaaggaaactcaccctaactgt, aatgatacggcgaccaccgagatctacactgcctggtggagcacaaaaggaaactcaccctaactgt) and 1x NEBNext Ultra Q5 MasterMix (NEB M0544L). Cycling parameters were as follows ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genomics 2024Quote: ... NaCl 5M stock was added to reach 1 M final concentration along with 30 µl of Streptavidin magnetic beads (NEB # S1420S) for 2 hrs with end-over-end mixing at 4°C to capture biotinylated DNA fragments ...
-
bioRxiv - Genomics 2024Quote: ... The aliquots were then divided into 3 digest reactions of 5 M cells and digested with the NlaIII restriction enzyme (NEB, R0125L). After subsequent proximity ligation and DNA extraction ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.01% Tween] to 3 µM concentration in a total volume of 50 µl and mixed with 20 μl of amylose beads (New England Biolabs, Ipswich, US-MA). After mixing the proteins and the beads ...
-
bioRxiv - Neuroscience 2020Quote: ... the first-strand of cDNA was synthesized using a random hexamer primer and M-MuLV reverse transcriptase (RNase H-) (New England BioLabs, Ipswish, MA, USA). Next ...
-
bioRxiv - Systems Biology 2023Quote: ... First-strand cDNA was subsequently synthesized using random hexamer primer and M-MuLV reverse transcriptase (RNase H-) (New England BioLabs, Ipswich, MA, USA). Next ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reversely transcribed into cDNA from 1 μg of mRNA template using the M-MuLV cDNA Synthesis Kit (New England Biolabs, Frankfurt am Main, Germany) according to the protocol of the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment encoding SNAP-tag was amplified from the pSNAP-tag (m) vector (a gift from New England Biolabs & Ana Egana, Addgene #101135), and then inserted into the pDisplay vector (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: ... nuclei from 2 million MCF-7/NA12878 cells at a viability of ∼95% were resuspended in 200 μl of reaction buffer (1× NEB CutSmart buffer, 0.3 M sucrose). Nuclei were then treated with EcoGII by adding 200 U of EcoGII (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The first cDNA synthesis was initiated by adding 1 U/µL RT at final concentration (NEB #M0277L for AMV RT, NEB #M0368L for ProtoScript II RT, and NEB #M0253L for M-MuLV RT). After 20 minutes of incubation at 37°C ...