Labshake search
Citations for New England Biolabs :
1 - 50 of 215 citations for Oleoyl Gly Lys m PEG11 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... without its Stop codon and with a Gly-Gly-Ser-Gly-linker at the 3’-end was first amplified using Q5 High-Fidelity DNA Polymerase (New England Biolabs) and the primers GGB_OEP7_F – AACAGGTCTCAAACAATGGGAAAAACTTCGGGAGC and GGC_OEP7_GGSG_R – AACAGGTCTCTAGCCTCCAGATCCTCCCAAACCCTCTTTGGATGTGG ...
-
bioRxiv - Plant Biology 2023Quote: ... and endoproteinase Lys-C (NEB-P8109S) at a ratio of (1:25 ...
-
bioRxiv - Biochemistry 2024Quote: ... or T7 Express Lys/IQ (New England Biolabs, C3013I). Cells were transformed with an expression plasmid (e.g ...
-
bioRxiv - Biophysics 2022Quote: ... 1 µL of 0.4 µg µL-1 Lys-C (NEB) stock was added (enzyme:substrate ratio of 1:100 w/w ...
-
bioRxiv - Molecular Biology 2022Quote: ... and tRNA-Gly-CCC (Table S1) were radioactively labeled with gamma-32P-ATP using T4 PNK (NEB). Pre-hybridization and hybridization were performed in OligoHyb Buffer (Applied Biosystems ...
-
bioRxiv - Biophysics 2023Quote: ... Amine-modified DNA oligonucleotides (NH2/GTGATGTAGGTGGTAGAGGAA) were linked to the benzylguanine (BG; NEB), and BG-oligonuculeotides were labeled with myosin II containing a C-terminal SNAP-tag (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H3 (Lys 9) rabbit pAb (PTM Biolabs, SKU: PTM 305), Butyryl-Histone H3 (Lys 23 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H3 (Lys 23) mouse mAb (PTM Biolabs, SKU: PTM 307), Butyryl-Histone H4 (Lys 8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H4 (Lys 5) rabbit pAb (PTM Biolabs, SKU: PTM 313), Butyryl-Histone H3 (Lys 27 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H3 (Lys 27) rabbit pAb (PTM Biolabs, SKU: PTM 315).
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H4 (Lys 12) rabbit pAb (PTM Biolabs, SKU: PTM 308), Butyryl-Histone H3 (Lys 9 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H4 (Lys 8) rabbit pAb (PTM Biolabs, SKU: PTM 311), Butyryl-Histone H4 (Lys 5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein digestion was achieved by sequential addition of endopeptidase Lys-C (BioLabs) and trypsin (Pierce™ ...
-
bioRxiv - Microbiology 2020Quote: ... sfgfp was cloned in-frame with tssB and a short linker (encoding 3×Ala 3×Gly) by Gibson Assembly (New England Biolabs) into pNCC1-Spec to allow IPTG-inducible expression of TssB-sfGFP ...
-
bioRxiv - Biophysics 2023Quote: ... we dilute the stock DNA to a final concentration of 6 mg/mL with 1/10th volume of 10× CutSmart Buffer (0.5 M Potassium Acetate, 0.2 M Tris-acetate, 0.1 M Magnesium Acetate; New England BioLabs), 0.1% Tween (to prevent non-specific interactions) ...
-
bioRxiv - Immunology 2022Quote: ... and 789-203-3C12 IgG was digested with endoproteinase Lys-C (New England Biolabs) overnight at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Aβ40 fibrils were digested using the Endoproteinase Lys C enzyme (New England BioLabs, Ipswich, MA) at a 1/50 (w/w ...
-
bioRxiv - Plant Biology 2022Quote: ... The digestion buffer (25mM triethylammonium bicarbonate (TEAB)) contained the Lys-C protease (P8109S, NEB, Australia) at a 1:20 protease to protein ratio ...
-
bioRxiv - Cell Biology 2024Quote: ... Val206 of Envy was mutagenized to Lys with the Q5 Site-Directed Mutagenesis Kit (NEB #E0554S) using primers listed in Table S2 ...
-
bioRxiv - Biochemistry 2021Quote: ... The alkyne-PAR was purified to remove excess alkyne-PEG1-amine using the Monarch Nucleic Acid Cleanup Kit (NEB) following the recommended protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... M: New England Biolabs (NEB) marker ...
-
bioRxiv - Genomics 2022Quote: ... The pellet was resuspended in 1 mL of NEB and centrifuged at 11,000rpm for 20 min on a sucrose gradient (0.65 mL of 1.6 M sucrose in NEB, 0.35 mL of 0.8 M sucrose in NEB). The Nuclei pellet was then resuspended in 1 mL of NEB ...
-
bioRxiv - Neuroscience 2020Quote: ... The nuclei-containing pellets were resuspended in 1 mL of NEB + 0,25 M sucrose and centrifuged at 20000xg for 20 min on sucrose gradient (0.65 mL of 1.6 M sucrose in NEB, 0.35 mL of 0.8 M sucrose in NEB). The pellet was resuspended in 1 mL of NEB and formaldehyde to a final concentration of 1% ...
-
bioRxiv - Microbiology 2020Quote: ... and M-MuLV reverse transcriptase (NEB) with buffer ...
-
bioRxiv - Genomics 2022Quote: ... 200 μ M GTP (NEB, N0450S)).The run-on reaction was stopped by adding Trizol LS (Life Technologies ...
-
bioRxiv - Genomics 2023Quote: ... and Phusion polymerase (M-0530, NEB) was used when DNA fragments were sequenced or used for molecular cloning ...
-
bioRxiv - Neuroscience 2023Quote: ... M-MLV RT buffer (NEB; B0253S) 1X ...
-
bioRxiv - Molecular Biology 2023Quote: ... M-MuLV Reverse Transcriptase (NEB, M0253L), RNase inhibitor (NEB ...
-
bioRxiv - Genomics 2022Quote: ... and Phusion polymerase (M-0530, NEB) was used when DNA fragments were sequenced or used for molecular cloning ...
-
bioRxiv - Biochemistry 2024Quote: Fab Fragments were generated by taking .5 mg of IgG and digesting with 2 µL of Lys C (NEB#P8109S) at 37℃ ...
-
bioRxiv - Microbiology 2021Quote: ... and M-MuLV reverse transcriptase (NEB M0253). For quantitative RT-PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... M-1 was digested with AflII (NEB) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 U M-MuLV RT (NEB) in RT Buffer (25 mM KCl ...
-
bioRxiv - Molecular Biology 2020Quote: ... M-MuLV reverse transcriptase (New England Biolabs) and oligo-d(T ...
-
bioRxiv - Systems Biology 2023Quote: ... and M-MuLV Reverse Transcriptase (NEB M0253). qPCR was performed in biological and technical triplicate using an Applied Biosystems QuantStudio 3 Real-Time PCR System with Fast SYBR Green Master Mix (Thermo Fisher 4385617) ...
-
bioRxiv - Microbiology 2021Quote: ... MeV-M BiFC constructs were made by exchanging NiV-M fused to VN173 or VC155 for MeV-M using the Gibson Assembly Cloning Kit (New England BioLabs). All mutant plasmids were generated using the Q5 site-directed mutagenesis kit using PAGE-purified mutagenesis primers designed using the online NEBase Changer primer design tool (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5 μL of M-MuLV reverse transcriptase (NEB), and 1 µL of murine RNase inhibitor (NEB ...
-
bioRxiv - Genomics 2022Quote: ... 200 μ M ATP (New England Biolabs (NEB), N0450S) ...
-
bioRxiv - Genomics 2022Quote: ... 200 μ M ATP (New England Biolabs (NEB), N0450S) ...
-
bioRxiv - Plant Biology 2021Quote: ... M-TM2^2 was digested with BslI (NEB) for 3 hours at 55°C and M-2 was digested with XhoI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 1X M-MuLV Reverse Transcriptase buffer (NEB, M02553L) and 10 U/mL of M-MuLV Reverse Transcriptase (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... and M-MuLV Reverse Transcriptase (New England Biolabs) per the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... and M-MuLV Reverse Transcriptase (cat# M0253S, NEB). qRT-PCR reactions were done using TaqMan® Fast Advanced Master Mix (cat# AB-4444557 ...
-
bioRxiv - Bioengineering 2023Quote: XhoI restriction enzyme (NEB cat. no. R0146S/M)
-
bioRxiv - Cancer Biology 2024Quote: ... Next 2μl of M-MuLV buffer (NEB, M0253S), 0.25μl of Protector RNase Inhibitor (Roche ...
-
bioRxiv - Biophysics 2023Quote: ... Trypsin digestion was initiated by adding 1:10 (trypsin to protein, m/m) mass spectrometry grade trypsin (New England Biolabs #P8101S) in 50 mM ammonium bicarbonate ...
-
bioRxiv - Immunology 2022Quote: Plasmids containing a cDNA encoding the full-length M segment from SNV (pWRG/SN-M(opt) 67 and pWRG/AND-M(opt2) 68 were used mutagenized using the Q5 Site-Directed Mutagenesis Kit (NEB, Cat# E0554S). Primers were designed using the NEBaseChanger tool (https://nebasechanger.neb.com/) ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of genomic DNA were digested and loaded into each lane. Mouse (M. musculus and M. spretus) genomic DNA was digested with methylation-sensitive (HpyCH4IV, NEB cat. R0619L) or methylation-insensitive (ApoI ...
-
bioRxiv - Molecular Biology 2024Quote: ... resuspended in spheroplast buffer (1.2 M sorbitol, 0.1 M potassium phosphate, 20 mM vanadyl ribonuclease complex [NEB, S1402S], 20 μM beta-mercaptoethanol) and digested with 0.002% 100 T zymolyase (US Biological ...
-
bioRxiv - Neuroscience 2021Quote: ... m and f plasmids using HpaI and AccI (NEB). The first linker ...