Labshake search
Citations for New England Biolabs :
201 - 250 of 624 citations for Mouse Anti Human Papilloma virus type 18 718 67 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... Small RNA sequencing libraries were prepared using the NEBNext Multiplex Small RNA Library Prep Set for Illumina following the manufacturer’s recommendations with the 3’ ligation step changed to 16°C for 18 hours to improve capture of methylated small RNAs (New England Biolabs, cat# E7300S). Small RNA PCR amplicons were size selected on 10% polyacrylamide non-denaturing gels ...
-
bioRxiv - Genomics 2021Quote: ... gDNA was digested with the CspCI Type IIB restriction enzyme (IIB-REase - New England BioLabs, Inc.) which has shown to yield a high marker density in triatomine65 ...
-
bioRxiv - Cell Biology 2020Quote: β1-tubulin wild type construct was generated by the gibson assembly (HiFi Kit, New England Biolabs) of a TubB1 sequence fragment synthesised as a gBlock by Integrated DNA Technologies (IDT ...
-
bioRxiv - Developmental Biology 2020Quote: ... followed by digestion of the wild-type strand with the enzyme BsurI (New England Biolabs, R0581S)[27] ...
-
bioRxiv - Microbiology 2020Quote: ... The wild-type Chlamydia trachomatis ct276 gene was amplified by PCR with Phusion DNA polymerase (NEB) using 100 ng C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Golden gate (Type-IIS) cloning was conducted using chemically competent Escherichia coli DH5α cells (NEB, C2987H). Construction of destination vectors with the toxic selection marker ccdB was done with chemically competent One Shot ccdB Survival 2 T1R E ...
-
bioRxiv - Immunology 2022Quote: ... with short homologies for Gibson assembly and cloned into human IgG1 or human IgL2 expression vectors using the NEB Hifi DNA Assembly mix (NEB, Cat#E2621L). Plasmid sequences were verified by Sanger sequencing (Genewiz).
-
The conserved metalloprotease invadolysin is present in invertebrate haemolymph and vertebrate bloodbioRxiv - Cell Biology 2019Quote: ... Human plasma was treated with PNGase F (NEB; P0704S) or a mixture of O-Glycosidase (NEB ...
-
bioRxiv - Biophysics 2020Quote: ... as with commercially available human H1 (hH1) (M2501S; NEB), sharing 96.5% identity with mH1 (Fig ...
-
bioRxiv - Biochemistry 2023Quote: ... and human casein kinase II (New England BioLabs, #P6010).
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Recombinant human Histone H2A (New England BioLabs, Catalog # M2502S) or H4 (New England BioLabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... Mutations were introduced into UNC-45B wild-type using the Q5® Site-Directed Mutagenesis Kit (NEB). Recombinant protein expression was induced in BL21 DE3 when optical density (OD600 ...
-
bioRxiv - Microbiology 2019Quote: ... Genes of interest were amplified from Synechocystis 6803 wild type genomic DNA with the Phusion Polymerase (NEB) according to manufacturer’s guidelines ...
-
bioRxiv - Plant Biology 2019Quote: ... the sgRNA vectors were digested with the type IIS restriction enzyme BsaI (New England Biolabs, cat#R0535S) and dephosphorylated with Calf Intestinal Alkaline Phosphatase (Takara ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting plasmid pFN_7_37_2k_kanRn was generated by the type IIS restriction enzyme BbsI and T4 DNA ligase (both NEB, USA). Another version of kanR with slightly different 5’ and 3’UTR was generated by PCR using the primer pair F13 ...
-
bioRxiv - Cell Biology 2022Quote: ... the wild-type and OGG1 (G245A) coding sequences were amplified by PCR with Phusion DNA polymerase (NEB) (primers indicated in Table S2 ...
-
bioRxiv - Immunology 2023Quote: ... we pooled all the eBlocks at equal molar ratio and used PaqCI Type IIs restriction enzyme (NEB), NEBridge Ligase Master Mix (NEB) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and ligated into the BioID plasmid using type II restriction enzymes BamHI and XhoI (New England BioLabs) and T4 DNA ligase ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The variants were created from the wild type plasmids using the Q5 Site-Directed Mutagenesis Kit (NEB) and transformed into MegaX cells made chemically competent (Mix & Go E ...
-
bioRxiv - Cell Biology 2024Quote: ... wild-type or mutant VPS35L sequences were amplified using Q5 High-Fidelity 2X Master Mix (NEB, M0492) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of human recombinant histone H4 (BioLabs, Cat# M2504S) was incubated with 50 μM n-butyryl- or isobutyryl-CoA and 0.2 μM of HAT1 at 30 °C for 1 hour ...
-
bioRxiv - Immunology 2020Quote: CAR-encoding mRNA was transcribed from linearized plasmids encoding anti-human CD19 CAR61 and anti-mouse CD19 CAR71 using T7 RNA polymerase (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs). The mRNAs were transcribed to contain the 5′ UTR derived from the human a-globin 5′ leader RNA ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were washed three times with a PBS buffer 1X and then incubated with mouse anti-MBP (NEB, Cat# E8032L) or rabbit anti-V5 (Cell Signaling Technology ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and about 200 ng of DNA was digested with the type II b enzyme BcgI (New England Biolabs). This enzyme cuts both upstream and downstream of the 6 bp recognition site ...
-
bioRxiv - Microbiology 2019Quote: ... 10 ng of DNA derived from colonies of BW25113 and BW25113ΔxerC infected with either EC6098 wild type or EC6098ΔdifC were cut with restriction enzyme HindIII (NEB) for 1h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA of wild-type and stat3 mutants were generated by the ProtoScript First Strand cDNA Synthesis Kit (NEB) using random primers ...
-
bioRxiv - Bioengineering 2023Quote: ... cloning was achieved via one-pot restriction-ligation reactions with type IIS restriction enzymes (NEB or Thermo Scientific) and T4 DNA ligase (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... pREP81-FLAG plasmid carrying wild-type srs2+ was constructed using the Gibson Assembly® Cloning Kit (NEB E5510S). After Gibson cloning ...
-
bioRxiv - Systems Biology 2023Quote: ... the wild-type protein extracts were incubated with 40 units of Lambda Protein Phosphatase (New England Biolabs, P0753S) at 30°C for 30min ...
-
bioRxiv - Microbiology 2024Quote: ... using a golden gate assembly strategy (19) and a type-II restriction SapI enzyme (New England Biolabs, R0569). A similar cloning strategy was used to build vectors bearing a JcDV viral genomes with fragments of cellular genes (~160 nucleotides ...
-
bioRxiv - Developmental Biology 2024Quote: ... the rbm8a wild type allele was genotyped by restriction digest of the PCR product with Xmn1 (R0194S, NEB) and the rbm8aΔ3 allele by Hinf1 (R0155S ...
-
bioRxiv - Neuroscience 2023Quote: ... This was confirmed in N1 heterozygous AtrxR245C/+ females after digestion of the wild-type allele using FspI (NEB R0135S) and gel purification of the uncut mutant band ...
-
bioRxiv - Immunology 2023Quote: ... We pooled the second set of eBlocks at equal molar ratio and used Esp3I Type IIs restriction enzyme (NEB), NEBridge Ligase Master Mix ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and terminator) was assembled in one-pot Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs, NEB). Transcription units to assay the sensor output contained the PQS promoter expressing the gfp gene ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and terminator) was assembled in one-pot Type IIS DNA assembly reaction using BsaI-HFv2 (New England Biolabs, NEB). Transcription units to assay the sensor output contained the PQS promoter expressing the gfp gene ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 μL of entry vector (backbone), 0.5 μL of type IIs restriction enzyme (BsaI, BsmBI or BbsI-HF) (NEB), 0.5 μL of T4 DNA Ligase (NEB) ...
-
bioRxiv - Biochemistry 2021Quote: Recombinant human CHIP was expressed in BL21(DE3) (New England Biolabs) E ...
-
bioRxiv - Cell Biology 2024Quote: ... coli-derived recombinant human histone H1 (NEB, Ipswich, MA, USA #M2501), H2A (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... with rotation for 1 hour at room temperature followed by further incubation for 1 hour with the addition of 15 μl of goat anti-mouse IgG magnetic beads (New England Biolabs, Ipswich, MA, USA). The magnetic beads in the supernatant were collected on a magnetic stand and washed 2 times with PBS ...
-
bioRxiv - Microbiology 2019Quote: In vitro transcribed 3X-FLAG tagged manY transcripts – wild-type or Δenh (1 pmol) were translated in vitro using the PURExpress translation kit (NEB). Translation reactions were stopped by adding Laemmli sample buffer (Bio-Rad) ...
-
bioRxiv - Biophysics 2022Quote: ... single point mutations were introduced to the respective wild-type plasmids by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (NEB). The used primers are listed in table 1.
-
bioRxiv - Microbiology 2019Quote: ... were amplified from genomic Synechocystis 6803 wild type DNA using specific primers (Table S1) and Phusion Polymerase (New England Biolabs). After restriction digest with BamHI and NotI ...
-
Calibrated feedback illumination for precise conventional fluorescence and PALM imaging applicationsbioRxiv - Biophysics 2019Quote: ... Wild-type ADE2 was amplified from genomic DNA, RB201 (W303 MATa, trp1, leu2, ura3, his3, can1R, ADE2) with Phusion PCR (NEB) using the forward primer (ATGGATTCTAGAACAGTTGGTATATTGGGAGGGGGACAA ...
-
bioRxiv - Cell Biology 2019Quote: ... Genomic regions of about 1 kb were amplified from wild-type genomic lysates using Q5 Hot Start high-fidelity polymerase (New England Biolabs) with the following primers ...
-
bioRxiv - Genomics 2020Quote: We used the prepared DNA of each clone and the wild type gene for amplification by PCR with Q5 polymerase (NEB) using primers which included the minION barcodes adapters ...
-
bioRxiv - Biophysics 2021Quote: Wild-type MukB was 6×His-tagged at the C-terminus and was expressed from plasmid Pet21 in C3013I cells (NEB). For Immobilized His6-tagged MukB ...
-
bioRxiv - Biochemistry 2020Quote: ... Human wild-type TDP-43 was amplified in two separate PCR reactions excluding the NLS and reassembled using Gibson cloning (NEB) into a Doxycycline-inducible expression vector containing an N-terminal mClover3 tag ...
-
bioRxiv - Neuroscience 2019Quote: ... The R1320P mutation was created in a wild-type cDNA using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). Wild-type and R1320P mutant dNf1 were then subcloned into the pUAST-attB vector with an in-frame C-terminal fusion with eGFP cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... CASP1 and CASP4 CDS were amplified from the obtained library and cloned into the pMSCV-puro vectors The caspase-4 catalytically dead C258A pMSCV-puro vector was generated from the wild-type pMSCV-puro-CASP4 through site-directed mutagenesis by PCR using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The CASP4 and GSDMD-targeting lentiviral vectors (pGIPZ ...
-
bioRxiv - Cell Biology 2020Quote: ... The open reading frame for a KIF18A wild-type siRNA resistant construct51 and pEM791 vector49 were amplified with primers designed for Gibson Assembly (New England BioLabs). After confirming the correct sequence of the Gibson assembled plasmid ...