Labshake search
Citations for New England Biolabs :
1 - 50 of 624 citations for Mouse Anti Human Papilloma virus type 18 718 67 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: Recombinant wild-type human histone H1.0 (New England Biolabs, cat. # M2501S) was used for experiments with fluorescently-labeled nucleosomes ...
-
bioRxiv - Biophysics 2022Quote: Recombinant wild-type human histone H1.0 was used (H1; New England Biolabs M2501S). ProTαC and unlabeled ProTα were prepared as previously described (26) ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB); NEXTflex™ Small RNA Sequencing Kit v3 (PerkinElmer ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... DNase I (NEB; 18 U), and lysozyme (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: The cloning of human wild type Mad2 and the mutant Mad2R133A by the USER® method (NEB) into the pRSFDuet-1 vector (71341-3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 18 μL 25 mM dNTPs (NEB), 30 μL 0.1 M DTT (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Specific mutations in human PSEN1 were obtained by Q5 site-directed mutagenesis of the pMSCV-puro vector containing wild type human PSEN1.26 We designed primers for Q5 site-directed mutagenesis (New England Biolabs) with NEBaseChanger.neb.com and performed site-directed mutagenesis according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the Vaccinia virus Capping enzyme (NEB) and biotinylated RNA species were subsequently enriched by affinity purification using streptavidin beads yielding 0.6 to 1.3% of the sRNA preparation ...
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Genomics 2020Quote: Mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA), and XP12 phage DNA was obtained from Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-MBP monoclonal (NEB), anti-mouse-HRP (Dianova) ...
-
bioRxiv - Genomics 2019Quote: ... mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA, USA). E14 genomic DNA was extracted with a DNeasy Blood and Tissue Kit (QIAGEN ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Biochemistry 2020Quote: 18 µg HindIII-digested lambda DNA (NEB N3012S) was de-phosphorylated with 2 μL of Calf Intestinal Phosphatase (NEB M0290S ...
-
bioRxiv - Bioengineering 2021Quote: ... for 16 cycles annealing at 67 °C was mixed with 1 μL of ExoI (NEB) digested mixture as the template ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-MBP (NEB, E8032). Peroxidase and Alexa-fluor conjugated secondary antibodies were purchased from Jackson Laboratories and ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-myc (New England Biolabs), rabbit polyclonal anti- GFP (gift from Oliver Gruss ...
-
bioRxiv - Molecular Biology 2022Quote: ... The commercially available vaccinia virus capping system (NEB #M2080S) was used as a positive control.
-
bioRxiv - Plant Biology 2021Quote: ... 1 mM ATP and 0.85 U of T4 DNA ligase (67 U/μL) (New England BioLabs). Ligation was performed at 37°C for 2 hours and 16°C for 16 hours ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse monoclonal anti-MBP (1:2000, NEB), rabbit polyclonal anti-Spo11 (1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... depleted with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat, NEB, Figures 6 and S6), or not depleted (Figures 2B ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat; NEB, E6310X). rRNA-depleted RNA was converted to a library using NEBNext® Ultra™ II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... 37°C with vaccinia virus capping enzyme (New England Biolabs), as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... and Moloney murine leukemia virus reverse transcriptase (New England Biolabs). Using a QuantStudio 3 real-time quantitative PCR machine (Life Technologies) ...
-
bioRxiv - Microbiology 2022Quote: ... Clean RNA was first rRNA depleted using the NEBNext rRNA depletion kit (Human/Mouse/Rat) (NEB) before being prepared for sequencing using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Ribosomal RNA was removed using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) according to the manufacturer’s instructions with 6 µl total RNA used as input per sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were prepared using the NEBNext rRNA Depletion Kit v2 (Human/ mouse) (NEB #E7405), NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-MBP (New England Biolabs, RRID:AB_ 1559738), used at 1:5000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse anti-PPARα (1:25, Arigo Biolabs ARG55240). Alexa Fluor conjugated secondary antibodies (ThermoFisher Scientific ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Type IIs RE (0.5 μl, NEB), vector backbone and inserts were combined to make 10 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... Feany as a gift (67) and cloned into pcDNA4/TO SNCA(DM)-EGFP using BsrG1 and Xba1 (NEB). To prepare LmnB1 over-expressing construct ...
-
bioRxiv - Zoology 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (New England Biolabs, Evry, France) and random hexamer primers were used to transcribe 1 μg RNA in a 20 μl reaction into cDNA.
-
bioRxiv - Developmental Biology 2021Quote: ... All oligos were radioactively capped using Vaccinia virus capping system (NEB) and [α-32P]-GTP (Perkin-Elmer) ...
-
bioRxiv - Molecular Biology 2022Quote: ... some 18S rRNA samples) using truncated T4 RNA ligase K227Q (NEB) to protect the 3’-end of the rRNAs from degradation and to identify the true rRNA 3’-end after sequencing (Table S3) ...
-
bioRxiv - Molecular Biology 2022Quote: ... We then carried out rRNA depletion with the NEBNext rRNA Depletion Kit (Human/Mouse/Rat NEB # E6310S) using the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and libraries were prepared using the NEBNext rRNA Depletion Kit for Human/Mouse/Rat (NEB Cat#E6310). Adapter-ligated cDNA was amplified with 11 cycles of PCR to generate libraries ∼300 bp in length ...
-
bioRxiv - Neuroscience 2023Quote: Specificity of anti-H3K9Me3 was tested against two types of substrates: recombinant histone H3 (New England BioLabs, M2507S), which lacked methylation ...
-
bioRxiv - Genetics 2023Quote: ... Barcodes were amplified by PCR (CP21.P14: TCCTCATCCTCTCCCACATC, CP17.P12: GGACGAGGCAAGCTAAACAG, NEB Q5 for 20 cycles, Tm 67 °C). We added phasing nucleotides as well as overhangs for indexing primers using primer mixtures SL5.F[1-4] and SL5.R[1-4] (NEB Q5 for 20 cycles ...
-
Cdc42 promotes epithelial morphogenesis by coupling Par-complex and Crumbs recruitment via Par6-aPKCbioRxiv - Cell Biology 2019Quote: ... anti-MBP mouse 1/80,000 (E8032S, New England Biolabs). Western Blots were quantified using Fiji ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-myc (NEB/Cell Signaling, 2276; 1:1500) o/n at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse monoclonal anti Pan-Keratin (clone C11, NEB, 4545S). Primary antibodies were incubated with sections overnight at 4°C except for anti-CD3 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Wild type ϕ29 was purchased from NEB as positive control ...
-
bioRxiv - Biophysics 2022Quote: ... type IIS enzymes (BsaI, New England Biolabs #R3733 ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNAse type IV (New England Biolabs/ Bioconcept) in DMEM/F12 (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: All eight gene segments of the isolated H6N1 virus were amplified (NEB), purified (Omega ...