Labshake search
Citations for New England Biolabs :
201 - 250 of 10000+ citations for Human Carboxyl Terminal PDZ Ligand Of Neuronal Nitric Oxide Synthase Protein NOS1AP ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Assays were set-up using PURExpress in vitro protein synthesis kit (New England Biolabs) with a cloned full-length DHFR template ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was depleted of ribosomal RNAs using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) before they were used for library construction using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Removal of rRNA was carried out by use of the NEBNext rRNA Depletion Kit Human/Mouse/Rat (NEB) followed by strand-specific cDNA NGS library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... and/or SNAP-tag® ligands (Janelia Fluor® 646, provided by Luke Lavis, Janelia; SNAP-Cell® 647-SiR, New England Biolabs, S9102S) were applied for 15 min at a final concentration of 100 nM ...
-
bioRxiv - Cell Biology 2020Quote: ... S141A ABHD11 and H296A ABHD11 with C-terminal eGFP tags or HA tags were created using NEBuilder HiFi (NEB). ABHD11 was also cloned into a transfection vector ...
-
bioRxiv - Biophysics 2020Quote: ... The point mutants were subsequently cloned in the pNZopuAHis plasmid (C-terminal 6-HIS-tag) using EcoRV-AlnwnI (NEB) for the substrate-binding domain mutants and βamHI-AlwnI (NEB ...
-
bioRxiv - Biophysics 2020Quote: N-terminal strep-6xHis-TEV mTagBFP2 RanQ69L was cloned into the pST50 vector via Gibson Assembly (New England Biolabs). The plasmid was transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: Sec24D was subcloned from pEGFP Sec24D into pcDNA3.1 with an N-terminal myc-6xHis tag using Gibson Assembly (E5510, New England Biolabs). pcDNA3.1 was linearized with Not1 (R3189 ...
-
bioRxiv - Biophysics 2020Quote: ... with TEV-cleavable 6x-His tag at N-terminal of the gene cloned between NheI (New England Biolabs Inc.) and HindIII (New England Biolabs Inc. ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sox3.S - NM_001090679.1 (F: TATAGCATGTTGGACACCGACATCA; R: TTATATGTGAGTGAGCGGTACCGTG) into N-terminal V5-pBS entry plasmids using HiFi assembly (NEB #E2621) for pou5f3.3 and BamHI/XbaI for sox3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 404–561 with a C terminal His tag added was cloned into the pMAL-c5x vector (New England Biolabs), and were transformed in E ...
-
bioRxiv - Microbiology 2022Quote: ... pCHYC-1 and a 500 bp ‘hfaE C-terminal PCR product were digested with HindIII-HF and KpnI (NEB) and ligated with T4 DNA ligase (NEB) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Isolated genomic DNA was G-tailed at random DNA breaks using dGTP together with terminal transferase (NEB cat M0315S) and used as template for nested PCRs using G-tail specific primer bap2pc (5’- gtccagagccgtccagcaacccccccccccccc-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... N- and C-terminal linkers of R-iLACCO0.1 were deleted using Q5 high-fidelity DNA polymerase (New England Biolabs) to provide variants with different linker length ...
-
bioRxiv - Biophysics 2022Quote: ... The C-terminal Flag tag was introduced into pcDNA3.1-Spike-WT thanks to NEBuilder® HiFi DNA Assembly (NEB). The Flag tag was added during amplification of Spike-WT from pcDNA3.1-Spike-WT with the primers ...
-
bioRxiv - Microbiology 2024Quote: ... the sequence encoding amino acid residues 1 to 35 of the N-terminal end of BVG96_RS17270 (89) was PCR amplified using Q5 polymerase (NEB) and cloned via NEBuilder HiFi DNA Assembly (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... and 5 mM MgCl2) followed by a phosphorylation step of the 5’-terminal ends by the T4 PNK (NEB). This dsDNA duplex was ligated into the large plasmid digested with KpnI (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... Analytical amounts of twenty Argonaute proteins were synthesized from pET29a plasmids using PURExpress In Vitro Protein Synthesis kit (New England Biolabs, Inc., Ipswich, MA, USA). For large scale expression and purification of CbAgo ...
-
bioRxiv - Microbiology 2019Quote: ... in conjunction with the NEBNext® rRNA Depletion Kit for Human/Mouse/Rat (New England BioLabs, Ipswich, MA, USA) and the MICROBExpress kit (Invitrogen ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... Leishmania DNA (0.0017 ng/μL) was then enriched from the human DNA (25ng/μL) using NEBNext Microbiome DNA Enrichment Kit (NEB) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: mRNA was enriched from 100ng DNase treated total RNA using the NEBNext rRNA depletion Kit (human, mouse, rat, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... A 140-500 ng aliquot of total RNA was rRNA depleted using NEB’s Human/Mouse/Rat RNAse-H based Depletion kit (New England BioLabs). Following rRNA removal ...
-
bioRxiv - Microbiology 2020Quote: Fetuin was deglycosylated under denaturing conditions using Protein Deglycosylation Mix II kit (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... PhyR1 and PhyR2 proteins were overexpressed and purified using the IMPACT kit (New England Biolabs) following the manufacturer’s instructions and equal procedures for the four of them ...
-
bioRxiv - Molecular Biology 2019Quote: ... in vitro translation was performed using the PURExpress In vitro Protein Synthesis kit (NEB 6800) and the non-stop ribosome complex was purified as previously described in ref.38 ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was labeled with SNAP-Surface Alexa Fluor 647 labeling kit (New England Biolabs) according to the protocol provided by the manufacturer ...
-
bioRxiv - Biophysics 2022Quote: Plasmids expressing stdMCP-fusion proteins were generated using the NEBuilder HiFi DNA Assembly kit (NEB). To obtain plasmids carrying an stdGFP-tagged stdMCP gene ...
-
bioRxiv - Biochemistry 2024Quote: All protein mutagenesis was performed with the Q5 site-directed mutagenesis kit from NEB (E0554). Primers were designed with the NEBaseChanger tool (https://nebasechanger.neb.com/ ...
-
bioRxiv - Biochemistry 2024Quote: In Vitro Translation (IVT) was performed using the PURExpress in vitro protein synthesis kit (NEB). Each IVT reaction contained 4 μL of PURE Solution A ...
-
bioRxiv - Microbiology 2024Quote: ... The in vitro translation assay was performed using PURExpress In Vitro Protein Synthesis Kit (NEB). 24 μM of antibiotics were added individually to the translation mixture and incubated at 37 °C for 4 hours ...
-
bioRxiv - Molecular Biology 2020Quote: ... with primers to introduce BamHI and NotI sites and cloned into pcDNA4/TO-3xFLAG (C-terminal tag) using T4 DNA ligase (New England Biolabs). pcDNA4/TO-ORF24 202-752-3xFLAG (Addgene #138424 ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR amplification of the N-terminal region of TRIM1 was performed using Q5 High-Fidelity 2X Master Mix (New England BioLabs) with the primers ...
-
bioRxiv - Genomics 2020Quote: ... Beads containing the ssDNA extension products were suspended in 10 μl of polyadenylation master mix containing 2 units of terminal transferase TdT (New England Biolabs), 1x TdT buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... trcP or fragments of the trcP ORF were cloned into pHL100’s SmaI site with the 23 nt upstream sequence and the Flag tag sequence on the C-terminal using NEBuilder HiFi DNA Assembly Master Mix (NEB); subsequently ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by the insertion of a DNA fragment containing C-terminal 2×HA tag by NEBuilder HiFi DNA Assembly Master Mix (NEB). Finally ...
-
bioRxiv - Biochemistry 2019Quote: ... and cloned into a modified pOEM vector as HRV 3C-cleavable N-terminal GST fusion construct (GST-C1-GFP-NES) using the restriction enzymes NotI and AscI (NEB).
-
bioRxiv - Biochemistry 2019Quote: ... fused to a His-ZZ-TEV tag on the amino-terminus and a carboxy-terminal SNAPf tag (New England Biolabs)) and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...
-
bioRxiv - Microbiology 2019Quote: ... The full-length gene (with terminal NdeI and HindIII cut sites) was synthesized by overlap-extension PCR using Q5 polymerase with high GC buffer (NEB) and primers 979 and 987 (Supplemental Table 2) ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were expressed as N-terminal His6-Smt3 fusion constructs from either pET28-b vectors (expressed in T7 Express lysY/Iq (NEB) Escherichia coli (E ...
-
bioRxiv - Biochemistry 2020Quote: ... a maltose binding protein (MBP) and a Tobacco Etch Virus (TEV) protease cleavage site in the N-terminal via Gibson assembly (New England Biolabs) as per the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2020Quote: ... The entire mDHFR ORF was PCR amplified from a mDHFR plasmid with a C-terminal AviTag fused to the mDHFR fragment using Gibson Assembly (NEB). The backbone contained a T7 promoter ...
-
bioRxiv - Biochemistry 2021Quote: AcpP was expressed from a pET28a plasmid encoding acpP with a thrombin-cleavable N-terminal 6xHis tag in C3031I cells (NEB). 2L cultures of LB supplemented with kanamycin (25 μg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... An expression clone for the full-length GFP-DdMyo7 with a C-terminal prenylation site (CAAX) was generated using Q5 mutagenesis (New England Biolabs) to add codons encoding the CTLL* prenylation motif from Dictyostelium RasG (UNIPROT ...
-
bioRxiv - Cell Biology 2021Quote: ... and cloned into the pZE13d vector (Lutz and Bujard, 1997) with an N-terminal 6xHis tag via Gibson assembly (Hifi DNA Assembly, NEB) using ClaI and PstI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... open reading frames were cloned into a linearized pET28b vector with BamH1 and Xho1 in frame with a N- terminal 6x-His tag using Gibson HiFi assembly mix (NEB), 10 μL total reaction volume with 2 μL of linearized vector ...
-
bioRxiv - Biophysics 2022Quote: ... 2018) and a C-terminal 6x His tag and cloned into the pET21B vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Biochemistry 2022Quote: ... Constructs HsKHC-MDC and HsKHC-MDCL2-CaKip3 contained a cleavable C-terminal TEV-SNAP-6X-His tag (SNAP-tag from NEB). DARPin-D2 was ordered as a codon-optimized gene product from IDT and cloned into pET16b using Gibson Assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... The pDyn1 plasmid [the pACEBac1 expression vector containing insect cell codon-optimized dynein heavy chain (DYNC1H1) fused to an amino-terminal His-ZZ-TEV tag and a SNAPf tag (New England Biolabs) on the carboxy-terminus] and the pDyn2 plasmid (the pIDC expression vector with codon optimized DYNC1I2 ...