Labshake search
Citations for New England Biolabs :
201 - 250 of 3651 citations for 8 5 HEXYL 2 FURYL OCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... 8 μl of DNA polymerase I Klenow (NEB M0210, 5U/μl), and 4 μl of T4 DNA polymerase (NEB M0203 ...
-
bioRxiv - Microbiology 2020Quote: ... and diluted in 8 ml ligation buffer (1X ligation buffer NEB without ATP ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the addition of 8 U murine RNase inhibitor (NEB # M0314L) (Kearse et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 8 µl RNase III (1:1000 diluted, New England Biolabs) or RNase If (1:100 diluted ...
-
bioRxiv - Genetics 2024Quote: ... 1 µg of plasmid was incubated with 8 U M.SssI (NEB) at 37°C for 4 h for in vitro DNA methylation ...
-
bioRxiv - Bioengineering 2024Quote: ... pH 8.0) containing 8 units mL−1 proteinase K (NEB, P8107S) at 37 °C for 4 h ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)A RNA (GpppA) (NEB, # S1406S) and G(5′)ppp(5′)G RNA (GpppG ...
-
bioRxiv - Genetics 2020Quote: ... and 5 μl T4 PNK (NEB M0201, 5 U/μl), and incubated for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... 5′ de-capping with RNA 5′ pyrophosphohydrolase (RppH, NEB, M0356S), (3 ...
-
bioRxiv - Biochemistry 2020Quote: ... and G(5′)ppp(5′)G RNA (GpppG) (NEB, # S1407S) are from New England Biolabs (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’-cap was removed using RNA 5′ pyrophosphohydrolase (Rpph, NEB) followed by addition of a phosphate group to the 5’ end using T4 polynucleotide kinase (T4 PNK ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Plant Biology 2022Quote: Nucleic acids were digested using the Nucleoside Digestion Mix (NEB) with the following modifications ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the Monarch Nucleic Acid Purification Kits (T1020 and T1030, NEB) were used ...
-
bioRxiv - Molecular Biology 2022Quote: ... Butyryl-Histone H4 (Lys 8) rabbit pAb (PTM Biolabs, SKU: PTM 311), Butyryl-Histone H4 (Lys 5 ...
-
bioRxiv - Genetics 2019Quote: ... Flag-Mad-8 was generated by PCR followed by Gibson assembly (NEB) and the S359L substitution was verified by sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... the isolated glycoproteins are treated by α-2,3/6/8 neuraminidase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 M NaCl and 8 units/ml Proteinase K (New England Biolabs) in 1x PBS] ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... using 1/8 reaction of NEBNext dsDNA Fragmentase (#M0348, New England Biolabs) incubated at 37°C for 5 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μL of 2% SDS and 2 μL of proteinase K (New England Biolabs) were added and the solution was incubated at 37°C for 1 hour before purification with the Qiagen DNA clean up kit ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 μl 10X NEBuffer 2 (New England Biolabs) and nuclease-free water (total of 20 μl ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5′-cap was removed with RNA 5’ Pyrophosphohydrolase (Rpph, NEB), and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μL of 2 U L-1 ExoI (NEB) was added and incubated at 37 °C for 30 minutes then 80 °C for 20 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of GlycoBuffer 2 (NEB Cat # B0701S, 10X), 2 μL of 10% NP-40 (NEB Cat # B0701S ...
-
bioRxiv - Systems Biology 2024Quote: ... 2 µl of NEBuffer 2 (New England Biolabs B7002) and 1 µl of Klenow large fragment DNA polymerase (New England Biolabs M0210 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Biochemistry 2020Quote: ... then extended and inserted into pCS2+8 or pET28a linearized with EcoRI (NEB). All inserts were fully sequenced by Sanger sequencing at the Cornell Genomics Core Facility.
-
bioRxiv - Biochemistry 2019Quote: ... Peak fractions were pooled and passed over an 8 mL amylose column (NEB), washed with 5 CV of Amylose Wash Buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Genomics 2020Quote: ... 15 mM HEPES pH 8) and 20 μl of DNase I (M0303S, NEB). The Nuclease Flushing mix was loaded into the flow cell and incubated for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were then successively treated with 8 U/mL DNase I (NEB; M0303S) for 5 min at 37°C and 4 U/mL RNase I for 3 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 units Esp3I (NEB), 100 units T4 DNA ligase (NEB) ...
-
bioRxiv - Systems Biology 2021Quote: ... coli (NEB 5-alpha) and plated on L-medium [27] with 100 µg/mL ampicillin ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... coli (NEB 5-alpha) were used.
-
bioRxiv - Genetics 2023Quote: ... 5 U StuI (NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 U BbsI (NEB), 250 U T4 DNA ligase in 1X T4 ligase buffer with the remainder nuclease-free water into a 5 µL total reaction ...
-
bioRxiv - Zoology 2023Quote: ... coli (NEB 5-alpha). We injected donor plasmids (20 ng/µl ...