Labshake search
Citations for New England Biolabs :
351 - 400 of 3893 citations for 8 5 HEXYL 2 FURYL OCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: 5’ Phosphorylated RA3 oligonucleotides were adenylated using 5’ DNA Adenylation Kit (New England BioLabs E2610S), by mixing 1 μL of 100 μM of 5’ Phosphorylated RA3 ...
-
bioRxiv - Microbiology 2020Quote: A template-switching 5’ rapid amplification of cDNA ends (5’-RACE) kit (New England BioLabs) was used to map the transcription start site of rflP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pre-adenylation was performed on 5 nmoles using the 5’ DNA Adenylation Kit (NEB, E2610L) as follows ...
-
bioRxiv - Molecular Biology 2022Quote: ... Unligated linkers were depleted by using 5 U per sample of 5’ deadenylase (NEB, #M0331S) and RecJ exonuclease (Biosearch Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... IRES mRNAs were capped with the A(5’)ppp(5’)G cap analog (NEB # S1406L). Post-transcriptional polyadenylation was performed using E ...
-
bioRxiv - Genomics 2021Quote: ... 2 U M.CviPI (NEB), 160 μM S-adenosylmethionine (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM dNTPs (NEB), 0.5 µM forward and reverse primers (IDT) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 2 μl DTT (NEB) and 2 μl of ProtoScript® II were added and the mixture incubated at 42°C for 12 hours with a 105°C heated lid ...
-
bioRxiv - Microbiology 2023Quote: ... in NEBuffer 2 (NEB) for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 mM ATP (NEB) in a total volume of 25 μl ...
-
bioRxiv - Genomics 2023Quote: ... 1X NEBuffer 2 (NEB), 0.5 μM P5 primer ...
-
bioRxiv - Genetics 2020Quote: ... followed by gap repair by adding 2 µl of 10× NEBuffer 2 (NEB), 3 µl of dNTPs (2.5 mM each ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2’O-methylated using Vaccinia VP39 (2’O Methyltransferase) (New England Biolabs), then purified by phenol-chloroform extraction and ethanol precipitation.
-
bioRxiv - Biophysics 2021Quote: ... Fragmented 5’-OH sites were phosphorylated by treatment with 5 units of T4 polynucleotide kinase (NEB) for 1 hour at 37 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence in between the ORFs NCAS0D00680 and NCAS0D00690 was amplified (primers: Ncas_Int618_For 5′-GTTCGCCGGCCTTCCCGCGCTATGAAATTA and Ncas_Int618_Rev 5′-ATCAGGCGCCGAGCATAACCGCTCAAATGC) and inserted between the NaeI and KasI (NEB) restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... the DTB-GTP cap was removed leaving a 5’ monophosphate terminus using RNA 5’pyrophophohydrolase (NEB), RNA was bound to AMPure beads and eluted in low TE (10mM Tris pH8.0 ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence downstream of the ORF NCAS0C00690 was amplified (primers: Ncas_Int696_For: 5′-GGCCGGTACCAATTCATCTAGCAGGATGTAAAATG; Ncas_Int696_Rev: 5′-GAAAGCCGGCGTAGAGCATGCGAGGTTTGG) and inserted between the KpnI and NaeI (NEB) restriction sites in pRS404 (3) ...
-
bioRxiv - Molecular Biology 2019Quote: ... castellii genomic sequence upstream of the ORF NCAS0E03540 was amplified (primers: Ncas_Int701_For 5′-ATTCGGATCCTGCAGGCTGTTTGCTGTACT; Ncas_Int701_Rev 5′-GGTGGCGGCCGCGGGGTAACTATCCGCGTCTAA) and inserted between the BamHI and NotI (NEB) restriction sites in pRS402 (5) ...
-
bioRxiv - Microbiology 2021Quote: ... 5’ triphosphorylated RNA was capped with 3’-desthiobiotin-TEG-guanosine 5’ triphosphate (DTBGTP) (New England Biolabs) using the vaccinia capping enzyme (VCE ...
-
bioRxiv - Immunology 2022Quote: ... Vκcons 5’GGCTGCAGSTTCAGTGGCAGTGGRTCWGGRAC3’ and Jκ5SHM 5’AGCGAATTCAACTTAGGAGACAAAAGAGAGAAC3’ using Phusion High-Fidelity DNA Polymerase (New Englands Biolabs) and according to following program ...
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Bioengineering 2022Quote: ... and single amino acids were made by KLD site directed mutagenesis (New England Biolabs). Rotavirus antigens were designed based on optimized sequences described previously ...
-
bioRxiv - Molecular Biology 2020Quote: ... The nucleic acids were subsequently radiolabeled with γ32P-ATP using T4 polynucleotide kinase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Gel fragments of homozygous clones were extracted using Monarch Nucleic Acid Purification Kits (NEB) and submitted for Sanger Sequencing ...
-
bioRxiv - Immunology 2020Quote: ... and gel fragments of clones were extracted using Monarch Nucleic Acid Purification Kits (NEB) and submitted for Sanger Sequencing ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... Half of the fragmented nucleic acids were digested with RNase H (New England Biolabs) overnight at 37°C to serve as a negative control ...
-
bioRxiv - Microbiology 2023Quote: ... Extracellular nucleic acids were removed with DNase I (New England Biolabs, 20 U/mL) and RNase A (New England Biolabs ...
-
bioRxiv - Biochemistry 2023Quote: ... Amino acid substitution mutants were prepared using the Q5 mutagenesis method (New England Biolabs) with oligonucleotides from IDT ...
-
bioRxiv - Genomics 2020Quote: ... PCR amplification (8-9 cycles) was performed with 10 μL Fusion HF Buffer (New England Biolabs), 3.125 μL 10uM TruSeq Primer 1 ...
-
bioRxiv - Microbiology 2019Quote: ... and PCR enrichment (8 cycles) with NEBNext Multiplex Oligos for Illumina (New England Biolabs, Ipswich, MA). DNA concentrations were estimated using qPCR and the Kapa Library Quant Kit (Kapa Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgRNA.SFFV.RFP657 (sgRNA only for Cbl intron 7/8 targeting) using T4 DNA ligase (NEB, M0202S) (57) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6-8 µg of Cas9-mSA plasmid was linearized by Not1-HF restriction enzyme (NEB #R3189S). The 8.8kb linearized fragment was cut out from a 1.5% agarose gel and DNA was extracted using QIAquick Gel Extraction Kit (Qiagen #28115) ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA (200 ng) was digested with 8 U of high-fidelity ApekI (New England Biolabs, USA) at 75 °C for 2 h.
-
bioRxiv - Genomics 2019Quote: ... 20 ng of the forward backbone was amplified with Len_lib_linF and Len_lib_linR (Supplemental Table 8) using NEBNext High-Fidelity 2X PCR Master Mix (NEB); the minimal promoter and GFP was amplified from 10 ng of the pLS-mP plasmid using minGFP_Len_HAF and minGFP_Len_HAR (Supplemental Table 8) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.8 M guanidine HCl) containing 8 units/ml and Proteinase K (P8107S, New England Biolabs Inc.) was added freshly to the digestion buffer ...
-
bioRxiv - Genomics 2020Quote: ... each sample(8 μl) was mixed with 12.5 μl 2X Quick Ligation buffer (New England BioLabs), 2.5μL T4 DNA ligase (2000U/μL ...
-
bioRxiv - Neuroscience 2024Quote: ... and digested by proteinase K (New England Biolabs, 1:100 dilution to 8 units ml−1) overnight at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL T4 PNK buffer (NEB), 1 µL SUPER In (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 5 μL 10X CutSmart buffer (NEB), and 35 μL H2O at 37°C for 16 hours then 80°C for 20 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 µl 5’deadenylase (NEB) at 30°C for 30 min and removed by RNA Clean & Concentrator (Zymo Research) ...
-
bioRxiv - Biophysics 2022Quote: ... 5 units of Phi29 DNAp (NEB) was loaded in the presence of 20 nM RPA and the specified concentration of dNTPs.
-
bioRxiv - Genomics 2022Quote: ... 5 U of RecBCD (NEB, M0345), 10 μg BSA ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl T4 polynucleotide kinase (NEB), 1 μl T4 DNA Polymerase (NEB ...
-
bioRxiv - Immunology 2021Quote: ... 5 μL of GC Enhancer (NEB), 5 μL of 5X buffer,10 mM dNTPs ...
-
bioRxiv - Genomics 2021Quote: ... Subsequent 5’ dephosphorylation by CIP (NEB) followed by decapping with RppH (NEB ...
-
bioRxiv - Genetics 2020Quote: ... 5 µL SbfI-HF (NEB R3642L), 50 µL 10x CutSmart NEB buffer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli (NEB 5-alpha competent cells), isolated using the Monarch Plasmid preparation kit (NEB ...
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Genetics 2020Quote: ... and 5 μl CviAII (NEB R0640S). The digestion was performed at room temperature for 2 hours ...