Labshake search
Citations for New England Biolabs :
51 - 100 of 3651 citations for 8 5 HEXYL 2 FURYL OCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The 5’ and 3’ arms (5 to 8 kb) were amplified from a C57Bl/6 BAC clone by PCR using Q5 polymerase (New England Biolabs) and inserted into a cloning vector that contains frt-flanked SV-Neo for positive selection and Pgk-DTA and HSV-TK genes for negative selection (Jarvie et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Amplification with barcoded primers was performed with a few numbers of PCR cycles (5 to 8) and a high-fidelity polymerase (Q5, NEB). Amplified libraries were size-selected on a non-denaturing 8% acrylamide gel and purified ...
-
bioRxiv - Genomics 2024Quote: ... dATP (3x 1.5 µL of 10 mM solutions) and 8 µL of 5 U/µl Klenow fragment of DNA polymerase I (New England Biolabs) and a 30-minute incubation at 37°C with rotation ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... and DNA fragments were amplified by PCR with NEXTFlex primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) and further purified with AMPure XP beads to eliminate unligated primers and adapters ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 uL aliquots were removed at each time point and added to 2 uL 5 mg/mL Proteinase K (NEB) in 5% SDS ...
-
bioRxiv - Biophysics 2021Quote: ... of 0.1M sodium hydroxide: 0.02M 2-(n-morpholino) ethanesulfonic acid (MES) or 1X NEB DNase I reaction buffer (NEB B0303S ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated to hairpin adaptor 2 (ENDseq-adaptor-2, 5′-Phos-GATCGGAAGAGCACACGTCUUUUUUUUAGACGTGTGCTCTTCCGATC*T-3′ [*phosphorothioate bond]) (Quick ligation kit, NEB). To prepare libraries for sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 µl was used for BglII digestion (NEB, 2 hours at 37°C) and the products were loaded on a 2% agarose gel to confirm the pAS insertion ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.15mM of 7-deaza-dGTP (7-deaza-2′-deoxyguanosine 5′-triphosphate, NEB).
-
bioRxiv - Genetics 2021Quote: ... including 8 bp barcode and P5 overhang (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCATCTTTGTGGAAAGGACGAAA CACCG-3’) using the Q5 Hot Start High-Fidelity polymerase (NEB #M0494S) for 22-24 cycles ...
-
bioRxiv - Biochemistry 2021Quote: ... libraries were generated using 5 μl of the purified RT reaction product and 4-8 cycles of PCR with Q5 high fidelity polymerase (NEB, M0491S). PCR reaction products were column purified ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 5 min and then samples were incubated with ligation buffer (8 μl of 5x ligation stock (New England Biolabs, USA), 1 μl ligase and 31 μl of ultrapure water on each coverslip ...
-
bioRxiv - Developmental Biology 2023Quote: ... Eluted fragments were amplified by PCR with an appropriate number of PCR-cycles (5-8) using Custom NExtera PCR primers50 and the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs, M0541S). Amplified DNA was purified using Qiagen MinElute Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... The end-repaired DNA was ligated with 5 μl Adapter Mix (ONT, SQK-LSK110) using 8 μl NEBNext Quick T4 DNA ligase (NEB, E6056) at 21°C for up to 1h ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was buffer exchanged into enterokinase cleavage buffer (20 mM Tris pH 8, 50 mM NaCl, 2 mM CaCl2) and cleaved using bovine enterokinase (EK, NEB) at 16U/mg protein for 4 hrs ...
-
bioRxiv - Molecular Biology 2021Quote: ... after incubating the samples with 2 μl of RNase A (Thermo) at 37 °C for 2h and then with 8 μl of proteinase K (NEB) at 55 °C for 4h ...
-
bioRxiv - Immunology 2022Quote: ... 2018” tagmentation mix were either sorted into plates containing RCB buffer for condition “hiSDSprotK-TWEEN” (2 x RCB: 100 mM Tris-HCl pH 8, 100 mM NaCl, 40 µg/mL Proteinase K (NEB), 0.4 % SDS (Sigma ...
-
bioRxiv - Genomics 2021Quote: ... The PCR mix (8 µl H2O, 2 µl primer mix P5Solexa/P3Solexa, 10 µM each, 20 µl Phusion HF Mix [New England Biolabs]) was added to 10 µl cDNA ...
-
bioRxiv - Genomics 2021Quote: ... Fragmentation was carried out by adding 50 μL NEB Buffer 2 and 8 μL of 25 U/μL MboI restriction enzyme (New England Biolabs). Samples were incubated at 37 °C for 2 hours with rotation ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101, 2/5 Nuclease-free water, 1/10 CutSmart Buffer 10X (NEB)] ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 8 mM rNTPs (NEB #N0466S), 250 U T7 RNA Polymerase (NEB #M0251L ...
-
bioRxiv - Biophysics 2023Quote: ... 8 μl XhoI (NEB, R0146S) and 8 μl DpnI (NEB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 μl of the assembly reaction was transformed into 5 μl chemically competent cells (E. coli NEB 5-alpha, New England Biolabs). Circuit constructs were analyzed by PCR ...
-
bioRxiv - Physiology 2021Quote: ... 5’ end repair was done using T4 PNK with 2 mM ATP (NEB P0756S). Following RNA purification with Zymo Oligo Clean & Concentrator (D4060) ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adenylation reactions were conducted by adding 5 μL of NEB buffer 2 (NEB), 1 μL 10 mM dATP ...
-
bioRxiv - Developmental Biology 2023Quote: ... On-Bead 5’ Decapping reaction was done using NEBuffer 2 buffer (NEB, B7002S ®). Off-Bead Reverse Transcription followed the instructions in SuperScript ® IV Reverse transcriptase kit ...
-
bioRxiv - Immunology 2021Quote: ... were generated by introducing the corresponding amino acid mutations (Extended Data Fig. 5) using the Q5® Site-Directed Mutagenesis Kit (NEB) and per manufacturer’s protocol.
-
bioRxiv - Microbiology 2022Quote: ... 2 μg RNA were incubated for 30 minutes at 37°C with 2 μl RNA 5’ Pyrophosphohydrolase (NEB, M0356, 5,000 units/ml). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 kit (ZYMO ...
-
bioRxiv - Bioengineering 2024Quote: ... containing 0.06 % pluronic acid (F-127, final concentration) and 1 µL of each disulfide bond enhancer 1 and 2 (NEB #E6820). We used droplet oil consisting of 3M™ Novec™ HFE7500 Engineered Fluid (3M ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were split into two separate reaction tubes containing 8 μL of PCR product + 1 μL 10X NEB® Buffer #2 (New England Biolabs®). These were incubated in a thermocycler with an initial denaturation of 95 °C for 5 minutes ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 μL of 10 × GlycoBuffer 2 (supplied by NEB, 500 mM Sodium Phosphate, pH 7.5), and 1 μL of PNGase ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL of Phusion High Fidelity 2× Master mix (New England Biolabs, Beverly MA, USA) and 2 μL of 10 μM standard Illumina P1 and P2 primers ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB), followed by denaturation and re-annealing in a nexus GSX1 Mastercycler (Eppendorf ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was removed by adding 2 μL DNaseI and 5 μL 10x DNase buffer (NEB) to the purified RNA and incubated at 37C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... nucleic acid (5 μL) was used as template for reverse transcription using LunaScript® RT SuperMix Kit (New England Biolabs, Hitchin, UK) in 20 μL reaction volume ...
-
bioRxiv - Neuroscience 2022Quote: ... 8 µl klenow polymerase (NEB M0210L) and 37.5 µl Biotin-14-dATP (Thermo 19524016 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 8 ul 5X HF buffer (NEB), 1 ul 25 uM library 1st round forward primer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 8 μl 50% PEG 8000 (NEB), 1.3 μl T4 RNA ligase (30 U/µl ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 units of RNAse inhibitor (NEB), and 10 µm of malachite-green dye was added to each reaction.
-
bioRxiv - Neuroscience 2023Quote: ... 8 U/mL Proteinase K (NEB)) and incubated overnight at RT ...
-
bioRxiv - Biophysics 2023Quote: ... and 8 μl DpnI (NEB, R0176S) in 400 μl final volume ...
-
bioRxiv - Genomics 2020Quote: ... 8 units of SbfI and 8 units of HF-MseI (New England Biolabs, Frankfurt am Main, Germany). Digestion was performed at 37°C for 2 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ linker (5′-rAppGTGTCAGTCACTTCCAGCGG-3’, Dharmacon) was added using T4 RNA Ligase 2 (NEB, M0242S), followed by the PNK (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... This was added to 5 ml (per 2 L of culture) amylose resin (New England Biolabs) equilibrated in lysis buffer and left on a tube roller shaker at 4 °C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl 10 mM MnCl2 buffer and 0 or 2 μl lambda phosphatase (NEB #P0753S, USA) in 38 μl supernatant ...
-
bioRxiv - Developmental Biology 2021Quote: ... 8 μL 5x first-strand buffer (NEB), 2 μL 10 mM dNTPs (NEB) ...
-
bioRxiv - Genomics 2020Quote: ... 8 μl DpnII (400 U, NEB, R0543M) was added to each and samples were incubated at 37°C overnight with rotation.
-
bioRxiv - Bioengineering 2019Quote: ... 8 U/µl Taq DNA ligase (NEB), 2 mM β-Nicotinamide adenine dinucleotide (NAD+ ...