Labshake search
Citations for New England Biolabs :
201 - 250 of 5802 citations for 1 Butylpyrrolidin 1 ium 3 yl 2 cyclopentyl 2 hydroxy 2 phenylacetatechloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... containing 1x NEBuffer 2 (NEB, B7002S), 1 mM ATP ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µg bovine serum albumin (NEB), 10% glycerol (v/v ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL GlycoBuffer 2 (10 ×) (NEB), 10 μL 10% NP-40 (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... 2 (TOYOBO) and BsaI-HF (NEB) and incubated at 37℃ for 5 min and 16℃ for 5 min for three cycles ...
-
bioRxiv - Zoology 2022Quote: ... mRNA cap 2’-O-methyltransferase (NEB) and E ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 µl T4-PNK buffer (NEB), 2 µl T4-PNK (10 U/µl ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µl Q5 DNA Polymerase (NEB). Amplification was done with an initial denaturation at 95 °C for 30 sec followed by 40 cycles at 95 °C for 10 sec ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 U/mL YIPP (NEB).50 Af tRNA nucleotidyl transferase was purified with the same method and buffers as the MBP-MS2 fusion protein.38 The reaction was incubated at 37 °C for 2 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 U M.CviPI (NEB, Cat# M0227S), 160 μM S-adenosylmethionine (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µl of 10X buffer (NEB), and 833 µM of cytidine 3’-phosphate at 37° C for 1 hour ...
-
Promoter-adjacent DNA hypermethylation can downmodulate gene expression: TBX15 in the muscle lineagebioRxiv - Molecular Biology 2022Quote: ... pCMV-CLuc 2 (New England Biolabs) encoding the Cypridina luciferase was co-transfected with the test construct ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2µl 10× GlycoBuffer 2 (NEB) buffer at 37°C 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 µl 10% NP-40 (NEB) and 2µl 10× GlycoBuffer 2 (NEB ...
-
bioRxiv - Genetics 2024Quote: ... 2 µl Cas9 Protein (M0386, NEB), 0.5µl buffer (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 0.5 µL 10x NEBuffer 2 (NEB), 0.8 µL 8-HQ (500 µM ...
-
bioRxiv - Genomics 2024Quote: ... 0.5 µL 10x NEBuffer 2 (NEB), 1.3 µL water and 0.2 µL Therminator IX (NEB ...
-
bioRxiv - Immunology 2024Quote: ... 2 × RNA loading dye (NEB, #B0363S) were added to the system to stop the reaction and the RNA was separated by agarose gel electrophoresis.
-
bioRxiv - Molecular Biology 2024Quote: ... + 2 μL BlpI (NEB cat# R0585S) + nuclease-free water to 50 μL ...
-
bioRxiv - Microbiology 2024Quote: ... 2 U of quick CIP (NEB), and water as needed ...
-
bioRxiv - Molecular Biology 2024Quote: ... T4 RNA ligase 2 (M0239S, NEB), Leupeptin (PI78435 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM Vanadyl ribonucleoside complex (NEB), 2X SSC ...
-
bioRxiv - Genomics 2024Quote: 2 μL USER enzyme (NEB #M5505) was added to each PCR amplification reaction containing deaminated DNA library ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 2 mM VRCs (NEB # S1402S) were added ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 µL 10 mM dNTPs (NEB), and 1 µL DNA Polymerase I ...
-
bioRxiv - Biochemistry 2020Quote: ... Beads were resuspended in 1 volume of buffer A / 300 mM NaCl / 2 mM MnCl2 / 1 mM DTT and incubated with λ protein phosphatase (NEB) at 50 U / mL for 1 hour at 23°C with agitation ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... RT-PCR or qPCR was performed with 1 μl of 1:2 diluted cDNA using the Q5®Hot Start High-Fidelity 2X Master Mix (NEB) or the SYBR™ Green PCR Master Mix (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... dA-tailing was performed by incubating the chromatin-bead mixture for 1 hour at 37 °C with 1× NEB Buffer 2 (NEB, B7002), 0.5 mM dATP ...
-
bioRxiv - Molecular Biology 2020Quote: ... Products were then ligated to 3’ adaptor (/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/) by T4 RNA ligase 2(NEB) and 5’ adaptor (rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCr-GrArCrGrArUrCrNrNrNrCrGrArNrNrNrUrArCrNrNrN ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Vcan exon 2 and exon 3 were amplified using Phusion Taq (NEB, catalog no. F530L) (see SI) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Biochemistry 2023Quote: ... The tRNA 2’-3’ cyclic phosphate was removed by treatment with T4 PNK (New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ligated to the 3′ adapter by incubating with T4 RNA ligase 2 truncated mutant (NEB) and 1 µg of pre-adenylated adapter (5′rAppCTGTAGGCACCATCAAT/3ddc ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was ligated to the 3′ adaptor tRNA using T4 RNA ligase 2 (NEB, M0351L) for 2 h at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... A 5’-adenylated DNA adapter (5’-rAppAGATCGGAAGAGCACACGTCT-NH2-3’) was added to 3’-ends using truncated T4 RNA ligase 2 (New England Biolabs; M0242S). After ligation of the 5’-RNA adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC-3’ ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The base plasmid was digested with BmtI and XbaI (Library 1) or BsaI (Library 2) and purified on a 1% agarose gel using Monarch® DNA Gel Extraction Kit (NEB, T1020L). We used a Gibson Assembly reaction (NEBuilder® HiFi DNA Assembly Master Mix ...
-
bioRxiv - Genomics 2022Quote: ... 7 μl PEG 8000 (17.5% final) and 1 μl of T4 RNA ligase 2 KQ (NEB, M0373L) in 1X T4 RNA ligase buffer ...
-
bioRxiv - Biochemistry 2020Quote: 1 μg of N protein was dissolved in 36 μL H218O and 2 μL 10x glycobuffer (NEB). To this solution 2 μL PNGase F was added and the reaction mixture was incubated at 37 °C for 16 h ...
-
bioRxiv - Genomics 2021Quote: ... and NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 and 2 (NEB #E7335S, #E7500S), following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Molecular Biology 2022Quote: ... All enzymatic reactions were performed as a 1-step reaction with 1x Glycobuffer 2 (New England Biolabs), 10 μg RBD produced in CHO-S- ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were multiplexed with NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2) (NEB). Size selection steps were performed with Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2024Quote: ... tube 2: 20 µL VLP suspension + 6 µL water + 1 µL Proteinase K (200 µg/mL, NEB), and tube 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM CaCl2 and the indicated volumes of 2 units bovine pancreatic DNase I (New England Biolabs) were added for the indicated incubation times at 37 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 2 h followed by 1 h incubation with 10 units of CIP Alkaline phosphatase (#M0290, NEB). The digested DNA samples were purified and added to a BrdU conjugate preadsorbed microplate prepared according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 μL of 2 mg mL-1 Y289L GalT,46 50 μL of 500 kU mL-1 PNGase F (New England Biolabs, 5 U μg-1 of protein), and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2021Quote: ... ΔN1/2/3 and ΔDAD mutants were generated by Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) with HOXB13 WT or NCOR1 WT as a template ...
-
bioRxiv - Microbiology 2022Quote: ... 23 nt RNA (5’-GAAUCUAUACAUAAAGACCAGGC-3’) was capped with vaccinia capping enzyme and 2’-O-methyltransferase (NEB) and radiolabelled with [α 32P]-GTP ...
-
bioRxiv - Immunology 2020Quote: ... (2) and (3) was synthesized through HiScribe™ T7 ARCA mRNA Kit (with tailing) (New England Biolabs). All the mRNA products were concentrated and purified via EZ-10 Spin Column RNA Cleanup & Concentration Kit (Bio Basic Inc.) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’adapter was ligated to the dephosphorylated RNA using T4 RNA ligase 2 KQ (NEB, M0373L) at 25°C for 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...
-
bioRxiv - Molecular Biology 2023Quote: RNA 3′-ends were dephosphorylated in a 10 µL reaction with 2 µL T4 PNK (NEB; #M0201S) 1 µL of FastAP Thermosensitive Alkaline Phosphatase (ThermoFisher #EF0651) ...