Labshake search
Citations for New England Biolabs :
151 - 200 of 5802 citations for 1 Butylpyrrolidin 1 ium 3 yl 2 cyclopentyl 2 hydroxy 2 phenylacetatechloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... with NEBNext® Multiplex Oligos for Illumina Dual Index Primers Sets 1 and 2 (NEB). Manufacturer’s instructions were followed except the post-ligation bead clean-up ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA (400ng) was then ligated the 3’adaptor (5’-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3’) using T4 RNA ligase 2(NEB) for 4 h at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA (400ng) was then ligated the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Molecular Biology 2020Quote: 3’ linker ligation (1x PNK buffer, 800 u T4 RNA ligase 2 truncated KQ (NEB), 80 u RNaseOUT ...
-
bioRxiv - Molecular Biology 2023Quote: ... samples were incubated with 1.5 µl EndoH and 2 µl 10× GlycoBuffer 3 (all NEB) buffer at 37°C 1h ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were ligated to barcode primers 1-20 of NEBNext Index Primers for Illumina sets 1 and 2 (New England Biolabs) and libraries analysed using DNA High Sensitivity chip on an Agilent 2100 Bioanalyzer before being pooled ...
-
bioRxiv - Biophysics 2023Quote: ... and a reverse elongation primer (Supplementary Tables 1 and 2) and incubating for 1 cycle of annealing/extension with Q5 polymerase (New England Biolabs). dsDNA product was then incubated with ExoSAP-IT (Applied Biosystem ...
-
bioRxiv - Bioengineering 2024Quote: ... containing 0.06 % pluronic acid (F-127, final concentration) and 1 µL of each disulfide bond enhancer 1 and 2 (NEB #E6820). We used droplet oil consisting of 3M™ Novec™ HFE7500 Engineered Fluid (3M ...
-
bioRxiv - Microbiology 2024Quote: ... A 20 µL Gibson Assembly reaction was performed with 50 ng of vector at a 2:1 ratio for 1 hour (New England Biolabs NEBuilder HiFi DNA Assembly Master Mix ...
-
bioRxiv - Cell Biology 2023Quote: ... The small RNAs were then ligated to a 3’ adaptor (5’ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’; IDT) by T4 RNA ligase 2(NEB). The 5’ adaptor containing 6 nt barcode was ligated using T4 RNA ligase 1 ...
-
bioRxiv - Microbiology 2024Quote: ... Radioactively labelled tRNAs carrying a 2′,3′ cyclic phosphate at the 3′ end was dephosphorylated using T4 polynucleotide kinase (NEB) in 100 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... For reverse transcription (RT) 1 µg RNA was digested with 2 U of DNase I (NEB). After heat inactivation of the DNase at 70 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Ligation was performed by adding 1 unit of T4 RNA Ligase 2 enzyme (New England Biolabs) in 10 μl of 1X reaction buffer and incubating the reaction at 37°C for 60 min ...
-
bioRxiv - Microbiology 2023Quote: ... 2 µM each of gene- specific forward and reverse primers and 1 unit Phusion polymerase (NEB) were mixed in 1X HF Phusion buffer and 3% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 ng of purified PCR product and 1 µl of NEB 2 Buffer (New England Biolabs) in 9.5 µl total volume were first denatured for 5 min at 95°C and then rehybridized by cooling the sample at a rate of 2°C/s to 85°C and a rate of 0.1°C to 25°C to obtain potential heteroduplex DNA ...
-
bioRxiv - Genomics 2023Quote: 1-2 µg of extracted total RNA and polysomal RNA was treated with DNaseI (NEB, M0303) in a 100 µL reaction at 37 °C for 15 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 & 2; New England Biolabs). Number of PCR cycles was calculated using a real-time qPCR-based approach (Lion et al. ...
-
bioRxiv - Genetics 2024Quote: ... and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2; NEB E7335 and E7500). Library DNA was quantified using the Qubit ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl 1 M DTT and 5 µl T4 polynucleotide kinase (NEB, 10 U/µl, #M0201) and incubated at 37 °C for 2 h ...
-
bioRxiv - Genetics 2021Quote: ... 2 × 2 µg of gDNA were digested in parallel with 50 units of DpnII (NEB #R0543L) and NlaIII (NEB #R0125L ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 µl T4 DNA ligase buffer and 2 µl 10 mg/ml BSA (New England Biolabs). These reactions were placed in a thermocycler with following program ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL NEBNext Bacterial rRNA depletion solution and 2 µL Probe Hybridization Buffer (NEB, CN E7850) were mixed with cells on ice ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNase-free BSA (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM Vanadate (Sodium Orthovanadate, NEB, pre-incubated for ten minutes at 95 °C to dissociate Vanadate oligomers ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 μL 10 mM dNTPs (NEB), 9 μL Nuclease-free water ...
-
bioRxiv - Neuroscience 2020Quote: ... 2× Protoscript Buffer (New England Biolabs), 12 mM MgCl2 (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 μl Q5 polymerase (NEB, M0491), 10 μl Q5 reaction buffer and 31 μl H2O with the following protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x Phusion buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM Ribonucleoside Vanadyl Complex (NEB), Roche cOmplete™ ...
-
bioRxiv - Genomics 2020Quote: ... + 2 uL DpnI (New England Biolabs) + up to 100 uL water.
-
bioRxiv - Genetics 2020Quote: ... NdeI (NEB, Figure 2 and 5) and SacII (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl BSA (New England Biolabs), 10 μl dNTPs (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl SrfI (New England Biolabs), and MilliQ (until a volume of 50 μl) ...
-
bioRxiv - Systems Biology 2020Quote: ... 2 μL T4 ligase buffer (NEB), 1 μL BsmBI restriction enzyme (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 mM Vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher) ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 units Phusion Polymerase (NEB)) ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μL NlaIII (NEB, R0125L) in 100 μL reaction mixture at 37 °C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 2 units RNA-free DNAse (NEB) was added and reactions left at 37°C for 30 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... and Cap 2’-O-Methyltransferase (NEB), followed by another purification by RNA Clean & Concentrator (Zymo) ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 U DNAse I (NEB). Then sonicated on ice for 10 sec and boiled 15’ at 99°C after adding 25 μL of SDS-PAGE 5x loading buffer and resolved by SDS-PAGE ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 µl Endo H (NEB P0702S) and 3 µl of G3 reaction buffer (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 μl Q5 polymerase (NEB, M0491), 10 μl Q5 reaction buffer and 31 μl H2O with the following protocol ...
-
bioRxiv - Microbiology 2020Quote: ... After 2 U RNase H (NEB) treatment for 15 min at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl T4 ligase buffer (NEB), 1 μl T4 ligase (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x Q5 buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL PNGase F (NEB # P0704) was added to the filter and incubated for 3 h at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... and 2’-O-methyltransferase (NEB, M0366), following the one step protocol ...