Labshake search
Citations for New England Biolabs :
451 - 500 of 5802 citations for 1 Butylpyrrolidin 1 ium 3 yl 2 cyclopentyl 2 hydroxy 2 phenylacetatechloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: pTXB1 Halo 3C SARS-CoV-2 (2019-nCoV) Nsp1 1-179-Intein CBD (DU67780 was made using NEBuilder (New England Biolabs), amplifying the vector from existing clone DU28033 (pTXB1-HALO-Mxe Intein-CBD ...
-
bioRxiv - Synthetic Biology 2020Quote: Phosphorylate oligos by mixing 1-2 ul of each top-strand oligo along with 1x T4 ligase buffer and 1 ul T4 polynucleotide kinase (NEB). Polynucleotide kinase buffer will not work without supplementary ATP ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were heated for 1 minute at 100°C followed by the addition of 2 μL of peptide N-glycosidase F (New England Biolabs) to release the N-glycans ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA encoding aa 1-862 of mouse ZO-1 was amplified by PCR using KOD-Plus-Ver.2 DNA polymerase and subcloned into pMAL-cRI (New England BioLabs). Expression vectors for MBP-fusion proteins of PDZ1 ...
-
bioRxiv - Genomics 2021Quote: ... 10% Dextran sulfate Sigma D8906; 0.02% BSA Ambion AM2616; 1 mg/ml E.coli tRNA Sigma R1753; 2 mM Vanadyl-ribonucleoside complex NEB S1402S; 2XSSC) containing diluted probes and incubated over night at 30°C ...
-
bioRxiv - Genomics 2021Quote: ... The isolated mRNA was then used to prepare sequencing libraries using NEBNext Ultra II Non-directional RNA Library Prep Kit for Illumina and NEBNext Multiplex Oligos for Illumina (Index sets 1 and 2) (NEB). Next ...
-
bioRxiv - Systems Biology 2023Quote: ... and used as template for the 2nd PCR where Illumina barcodes were added by NEBNext Multiplex Oligos for Illumina (Dual Index Primers Set 1 and 2) (New England Biolabs). PCR products were purified using AMPure XP beads (BECKMAN COULTER) ...
-
bioRxiv - Genomics 2022Quote: ... for 2 hours and then crosslinked with p19 siRNA binding protein (1 μg/ml in depc-PBS; New England Biolabs) or anti-N6-methyladenosine (m6A ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.7 µl of the sample of eluted extension products were included in a 10 µl T4 RNA ligase 2 truncated KQ reaction (1× T4 RNA ligase buffer (NEB), 2 µM IllLigBio adapter pre-adenylated using a 5’ adenylation kit (NEB) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in 100 µL MNase reaction mix (87 µL ddH2O, 10 µL 10x MNase buffer, NEB, 1 µL 100x BSA, 2 µL 2000 U/µL MNase, NEB). Digests were centrifuged (5 min ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL of 5’ adenylated linkers (Supplementary Table 4) were added (33 pmol/μL) along with 1 μL T4 RNA ligase 2 truncated (New England BioLabs) and incubated at 25 °C for 2.5 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified lysate was applied to Glutathione Sepharose 4B affinity resin (1 ml bed volume per 2 l culture; New England Biolabs), and incubated with rotation for
-
bioRxiv - Genomics 2023Quote: ... and washed twice with 2 mL of CLB containing Superase-In and 1% v/v of 20 mg/mL molecular grade BSA (NEB). After the final wash ...
-
bioRxiv - Immunology 2022Quote: ... the pools of insert 1 and the pools of insert 2 were assembled using NEBuilder HiFi DNA Assembly Master Mix (NEB). The assembled product was bead-purified using Sera-Mag SpeedBeads (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µl from the PCR product were circularized using 1 µl T4 DNA ligase and 2 µl ligation buffer 10x (NEB) in a final volume of 20 µl ...
-
bioRxiv - Genetics 2024Quote: ... the targeted tars-1 region was amplified by PCR (primer sequences in Supplemental Table 2) using Q5 PCR mix (New England Biolabs). Amplicons were then purified with DNA Clean and Concentrator kits (Zymo Research ...
-
bioRxiv - Microbiology 2024Quote: ... The linearized vector and PCR-amplified sequences were mixed at a 1:2 molar ratio and assembled using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... primers with overlapping sequences (Supplementary Tables 1 and 2) were designed to generate point mutations with the NEBuilder HiFi DNA Assembly mix (New England Biolabs). Wild-type protein expression was performed in OverExpress C41 (DE3 ...
-
bioRxiv - Biochemistry 2023Quote: ... or targeting a specific sequence within the puromycin resistant cassette (P3 Supplementary Table 2) were mixed with 1 unit HiFi Polymerase (Q5 HF DNA Polymerase, M04915, NEB) and 1× HiFi reaction buffer with MgCl2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Dissociated cells were resuspended in 1ml of Cell Hashing Staining Buffer (1× PBS with 2% BSA (New England Biolabs, B9000S) and 0.02% Tween (Tween®-20 Solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA (1-2 μg) was reverse-transcribed using LunaScript™ RT SuperMix Kit (New England Biolabs, Catalog No; E3010S). Quantitative real-time RT-PCR (qRT-PCR ...
-
bioRxiv - Plant Biology 2022Quote: ... The cell lysate was collected and incubated for 1 h with 2 ml of 50% slurry of chitin resin (New England Biolabs) before loading onto an empty EconoPac gravity-flow column (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... Institut Jacques Boy), recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and DNase (1 U/ml, New England Biolabs), washed and enumerated ...
-
bioRxiv - Microbiology 2022Quote: ... 3 μL of 5’ adenylated linkers (Table S3) were added (33 pmol/μL) along with 1 μL T4 RNA ligase 2 truncated (New England BioLabs) and incubated at 25°C for 2.5 hours ...
-
bioRxiv - Immunology 2022Quote: ... Then 13 μl PCR heteroduplexes were digested by 2 μl of 1 U/μL T7 Endonuclease I (New England Biolabs) at 37°C for 60 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... Unbound material was removed by washing the samples 5x for 5min with head over head rotation at 4°C in wash buffer plus detergent (1x buffer XT, 1% digitonin, 2 mM PMSF and 10% glycerol) using a magnetic separator (New England Biolabs). Bound material was finally eluted with Biotin elution buffer (1x buffer Biotin XT elution ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The addition of an NLS or DST to level 1 and level 2 integrase constructs was performed using PCR-mediated site-directed mutagenesis (NEB Q5 Site-Directed Mutagenesis ...
-
bioRxiv - Immunology 2024Quote: ... supplemented with recombinant human IL-2 (rhIL2, 10 U/ml, Miltenyi) and Dnase I (1 U/ml, New England Biolabs). Cells were washed and 5-9 x 106 PBMCs were then seeded/well in a 24-well plate in IMDM supplemented with 10 % SAB ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were barcoded using NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and Set 2) (NEB, E7335S and E7500S). Paired end sequencing was performed (S1 and S2 ...
-
bioRxiv - Plant Biology 2024Quote: ... 2 µg of total RNA was circularised in a reaction containing 6 U T4 RNA Ligase 1 (New England Biolabs), 50 µM ATP ...
-
bioRxiv - Physiology 2024Quote: ... the following reagents were added to each tube containing 1 cell in ∼5 μL: 2 μL M-MuLV Reverse Transcriptase Reaction Buffer (New England Biolabs (NEB), Ipswich ...
-
bioRxiv - Genomics 2024Quote: ... 2 µL of 10X T4 Ligase Buffer and 1 µL of NEB Golden Gate Assembly Kit (NEB, catalog no. E1602L) with 65 cycles of digestion at 42°C and ligation at 16°C for 5 min each ...
-
bioRxiv - Cell Biology 2024Quote: ... then 30 μl denatured lysate were treated with 2 μl Endo H or 1 μl PNGase F enzymes (New England Biolabs) in 40 μl reactions according to the manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 2 μg RNA were incubated for 30 minutes at 37°C with 2 μl RNA 5’ Pyrophosphohydrolase (NEB, M0356, 5,000 units/ml). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 kit (ZYMO ...
-
bioRxiv - Molecular Biology 2024Quote: ... attB plasmid containing genes for tdMCP-protein fusions and a MS2-circRNA barcode were digested overnight at 37°C to remove existing barcode sequence (2 μg plasmid, 5 μL 10x CutSmart buffer, 2 μL BsrGI-HF (NEB cat#R3575S), nuclease-free water to 50uL) ...
-
bioRxiv - Molecular Biology 2024Quote: ... was digested by combining the following and incubating overnight at 37°C: 2 μg plasmid + 5 μL CutSmart buffer (10x) + 2 μL AflII (NEB cat# R0520S) + 2 μL BlpI (NEB cat# R0585S ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 h at 37°C and IFITM3-iSNAP was stained with 3 µM SNAP-cell 647-SIR (New England Biolabs) at the same time ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the NIR fluorescent adaptor (5′-OH-AGATCGGAAGAGCGGTTCAGAAAAAAAAAAAA/iAzid eN/AAAAAAAAAAAA/3Bio/-3′) was ligated to the RNA using truncated RNA ligase 2 K227Q (NEB) overnight at 16°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Beads containing the repaired DNA were resuspended in 50 μL of 1X NEBuffer 2 containing 0.1 mM dATP and 25 units of Klenow Fragment (3’→5’ exo-) (NEB, M0212M), and incubated at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2020Quote: ... NC-siRNA sense: 5’-AGGUAGUGUAAUCGCCUUGdTdT-3’.35,36 NEBuffer™ 2 and nucleoside digestion mix were obtained from NEB (Ipswich, MA). Adenosine and N6-methyl adenosine (m6A ...
-
bioRxiv - Molecular Biology 2021Quote: ... An adenylated adaptor was ligated to the 3’-end of the captured transcripts (Supplementary Table 3) by using a mixture of T4 RNA ligase and truncated T4 RNA ligase 2 (ThermoFisher Scientific and NEB), which served as a template for the reverse transcription primer (Supplementary Table 3) ...
-
bioRxiv - Genomics 2020Quote: ... followed by ligation of 3’ ends with pre-adenylated DNA adapters (App-GATCGTCGGACTGTAGAACTCTGAAC/3InvdT/) using T4 RNA Ligase 2 truncated K227Q (NEB) in absence of ATP ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... or MnlI was at 37 °C for 2 h (EcoRI-HF) or 3 h (HhaI or MnlI) in rCutSmartTM Buffer (NEB). Nuclease S1 (Boehringer Mannheim ...
-
bioRxiv - Systems Biology 2024Quote: ... We digested ∼2ug of each of 24 barcoded ORF plasmid pools (2 replicate pools of each of 9 hORFs and 3 vORFs) overnight with I-SceI (NEB) according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2024Quote: 100 ng polyA+ RNA was annealed with 2 μl of 10 μM Oligo(dT)30VN primer (5’-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) and 2 μl of 10 mM dNTP mix (NEB) in 12 μl solution ...
-
bioRxiv - Developmental Biology 2023Quote: ... for small RNA library preparation 50 to 300 ng of total RNA was ligated with randomized 3’ adapter using T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monophosphorylated RNAs were ligated to 3′ adapters ( rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight ...
-
bioRxiv - Genetics 2022Quote: ... Purified sRNA was ligated to a 32 nt 3’ adaptor including unique barcodes (sRBC, Table S5, IDT) with truncated T4 RNA ligase 2 (M0373L, NEB) overnight at 16°C ...
-
bioRxiv - Genomics 2022Quote: ... The DNA was digested with MluCI (5µl Cut smart buffer, 1.5-2 µg DNA, 3 µl MluCI (New England Biolabs Inc. (NEB), and water to make up 49 µl ...