Labshake search
Citations for New England Biolabs :
2351 - 2400 of 2930 citations for Acyl protein thioesterase 2 LYPLA2 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Homology fragments were assembled using the NEBuilder® 2 X HiFi DNA assembly master mix (NEB, Cat. No. #E2621), while guide RNAs were inserted by ligation using T4 ligase (NEB ...
-
bioRxiv - Biophysics 2023Quote: ... We digested the cosmid-i95 for 2 h at 37°C using SpeI-HF restriction enzyme (New England Biolabs) and heat-inactivated for 20 min at 80°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7.5 µL DNA was incubated (14 h, 37°C) with IVT mix (0.5 µL Ribolock inhibitor, Invitrogen, 2 µL T7 polymerase buffer, NEB, 8 µL rNTP mix ...
-
bioRxiv - Genomics 2023Quote: ... or 40,000 nuclei per well in 22 µL of NSB and 2 µL of 10 mM dNTP mix (NEB).
-
bioRxiv - Evolutionary Biology 2023Quote: ... All mutants (Arp2D subdomain 2 swap, Arp2D-2CT, and Arp2-2DCT) were generated using Q5 site-directed mutagenesis (NEB). All genes were cloned into a vector encoding an attB site and superfolder GFP under the control of an eye-specific promoter (3XP3) ...
-
bioRxiv - Developmental Biology 2023Quote: ... A primer set annealing to the amplification sequences was used at a final concentration of 0.5 μM to amplify the pool of oligonucleotides using 12.5 μL 2 x NEBnext PCR master mix (New England BioLabs) and 3 μL of oligonucleotide pool (∼3 ng) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of iTP_3’_linker_ApoI (10 μM) and 0.5 μl of ligase (T4 RNA ligase 2, truncated - 200 000 U/ml - New England Biolabs) per reaction ...
-
bioRxiv - Genetics 2023Quote: ... Input genomic DNA was first amplified in a 10μL reaction for 30 cycles using NEBNext High-Fidelity 2×PCR Master Mix (NEB). Amplicons were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µL i7 unique index primer (10 µM) and 25 µL NEBNext High-Fidelity 2X PCR Master Mix (NEB) and subjected to the following PCR program ...
-
bioRxiv - Microbiology 2023Quote: The pGEX-6P-PrkA1-338 plasmid (Table 2) was constructed by a two-part ligation (NEB Quick Ligation kit) of BamHI- and NotI-linearized pGEX-6P and PCR-generated prkA1-338 amplified with primers AS21 and AS81 (Table 3 ...
-
bioRxiv - Genomics 2023Quote: ... we amplified pegRNA/ngRNA pair sequences from each sample using NEBNext High-Fidelity 2× PCR Master Mix (NEB, M0541L) and the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... To produce the ABI1 Isoform 2 deleted SH3 domain we performed Q5 site-directed mutagenesis (New England Biolabs Inc.) with forward primer 5’-TAGCTCGAGGTTAACGAATTC - 3’ and reverse primer 5’-TTTCTCAATATAATTCTTGGGG - 3’ synthesized by IDT and then verified the sequence (Genewiz) ...
-
bioRxiv - Microbiology 2023Quote: ... Amplified PCR products were ran on 2% agarose gel and stained with ethidium bromide solution (New England Biolabs Inc.). Gel photographs were taken using ChemiDoc MP gel documentation system (BIO-RAD).
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
bioRxiv - Biochemistry 2023Quote: IVT and co-transcriptional capping reactions were performed in 30 μL reactions containing 1x T7 RNA polymerase buffer (40 mM Tris-HCl, 20 mM MgCl2, 1 mM DTT, 2 mM spermidine, pH 7.9; New England Biolabs), 5 mM each NTPs ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barcoded 3’ adapters (see Extended Data Table 1) were ligated using K227Q truncated T4 RNA ligase 2 (NEB, M0351L) at a concentration of 0.5 µM adapter and in the presence of 25% PEG8000 containing a homemade 10 x ligation buffer (0.5 M Tris pH 7.8 ...
-
bioRxiv - Bioengineering 2023Quote: ... and assembled with PCR amplified (primers 2 and 3) pRSET vector fragment using Gibson assembly (NEB Japan, Tokyo, Japan) to add T7 promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... mRNA Magnetic Isolation Module and NEBNext Multiplex Oligos for Illumina (Index Primers Set 1/2/3/4) following the manufacturer’s instructions (New England Biolabs). Quantification and quality checked of libraries was done using an Bioanalyzer 2100 instrument and DNA 7500 kit (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 0.5 μl of 100 mM phenylmethylsulfonyl fluoride] and incubated with micrococcal nuclease (2 × 103 U/ml; New England Biolabs) for 2 hours at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... Single cells of two untreated CeD patients were sorted into 96-well plates containing 2 µl of scRNA-seq catch buffer (0.2% vol/vol Triton X-100 [Sigma] in H2O with 2 U/μl RNase inhibitor [New England Biolabs]) per well using a FACSAriaIII instrument (BD) ...
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...
-
bioRxiv - Immunology 2023Quote: ... and ligated with custom UMI adapters (IDT) (Table S2) at 2 uM according to NEBNext Ultra II instructions (NEB). Libraries were prepped following NEBNext Immune Sequencing Kit’s protocol (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were digested with 0.4 μl of restriction enzyme NlaIII for 2 hours at 37°C (New England Biolabs). Digested PCR products were run on 2% agarose gels with SYBR Safe (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... for the elution from the columns 2 pg of Tn5-digested and purified lambda DNA (New England Biolabs, # N3011S) were added to be used as spike-in normalizer for later analysis ...
-
bioRxiv - Genomics 2024Quote: ... 2 µg of the plasmids containing the reporters and promoters (pJL206 or pJL261) were linearized with BciVI (NEB, R0596S) for 1 h at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR fragments were cloned into psiCHECK-2 using the restriction enzymes XhoI/NotI or SglI/NOTI (New England Biolabs). Ligations were performed with a quick ligation kig (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2024Quote: ... up to 2 μg of plasmid DNA was incubated for 4 h at 37°C with 2 μl of CpG Methyltransferase from M.SssI (NEB) in the Methyltransferase Reaction Buffer supplemented with 2 μl of diluted SAM (6.4 mM) ...
-
bioRxiv - Bioengineering 2024Quote: S-R1-R2-H stock (87.5 kDa, 2 - 4 μM) tagged with handle oligos was reconstituted in 1x T4 ligase buffer (NEB) in PBS with 0.05% NP-40 ...
-
bioRxiv - Immunology 2024Quote: ... Samples were then processed for library barcoding and amplification with Q5 High-Fidelity 2× Master Mix (cat. M0492S, NEB). Prepared libraries were sent for sequencing after quantification using Qubit and size distribution as determined using an Agilent 4200 TapeStation.
-
bioRxiv - Microbiology 2024Quote: ... The RT RNA sample (5 μL) was amplified using the LongAmp Taq 2× Master Mix (NEB, Ipswich, MA, USA) with IVT Nanopore T7 Fw and IVT Nanopore T7 Rv primers (Supplementary Table 5) ...
-
bioRxiv - Cell Biology 2024Quote: ... 100 pmol forward oligo and 100 pmol reverse oligo were resuspended in 25 μL 1x NEBuffer 2 (NEB, B7002S). The solution was incubated in a 95 °C water bath for 4 min then slowly cooled (∼0.5 °C/min ...
-
bioRxiv - Biochemistry 2024Quote: ... The reaction mix was incubated at 37°C and 15 ul aliquots were removed at indicated time points, quenched into stop buffer (1.8% SDS, 10 mM EDTA) followed by Proteinase-K (2 units total) (NEB) treatment for 45 min at 50°C ...
-
bioRxiv - Molecular Biology 2020Quote: Cleavage of the MBP tag from NlGr7 was completed according to manual instructions of the pMAL protein fusion and purification system (NEB, Inc, USA). The tag (MBP ...
-
bioRxiv - Molecular Biology 2020Quote: ... the desired sequences pertaining to the truncated forms of the N protein were subcloned from the synthetic gene using polymerase chain reaction (Phusion polymerase, New England Biolabs, Hertfordshire, UK). All genes were cloned into the modified pet28 vector and gene sequences were confirmed by Sanger Sequencing.
-
bioRxiv - Biochemistry 2022Quote: ... purified Trx-FER-KD and FER-KDK565R proteins were treated with 1 μl of λ-phosphatase (λ-PP) (400,000 units/ml, New England Biolabs. P0753S) and 1 mM MnCl2 for 1-2 h at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... protease mutant S219V [24] was inserted at the 3’ end of gene encoding maltose binding protein (MBP) in pMAL-c5E vector (New England Biolabs, MA, USA) to construct pMAL-TEV vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl of the gRNA mixture was mixed with Cas9-NLS protein (final concentration of 5 μM. New England Biolabs, Ipswich, USA), 2M KCl (final concentration of 300mM) ...
-
bioRxiv - Microbiology 2021Quote: ... 39 μl of each lysate was combined with 5 μl of 10X NEB buffer for Protein MetalloPhosphatases (New England Biolabs, Ipswich, MA), 5 μl of 10 mM MnCl2 and 1-2 μl (400-800 units ...
-
bioRxiv - Genetics 2020Quote: ... Zebrafish embryos were injected at the 1-cell stage with a 1 nL solution of bbs2 gRNA (200 ng/μL) and Cas9 protein (10 μM; New England BioLabs, Beverly, MA). Mutagenesis was confirmed by High Resolution Melt Analysis (HRMA ...
-
bioRxiv - Molecular Biology 2022Quote: ... deglycosylation treatment (Dglyco) consisted of sample incubation for 3 hours at 37°C with 20 nL of Protein Deglycosylation Mix II (NEB, cat. P6044S) per μL of sample ...
-
bioRxiv - Microbiology 2024Quote: ... 39 μl of each benzonase-treated lysate was combined with 5 μl of 10X NEB buffer for Protein MetalloPhosphatases (New England Biolabs, Ipswich, MA), 5 μl of 10 mM MnCl2 and 1 μl (400 units ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 - 400 ng of PCR fragments were used as template DNA to synthesize analytic amounts of DNA deaminases using PURExpress In Vitro Protein Synthesis kit (NEB, Ipswich, MA) following manufacturer’s recommendations.
-
bioRxiv - Evolutionary Biology 2024Quote: ... or four (white shavenbaby experimental) sgRNA targeting the first or second exon (100 ng/μl) and CAS9 protein (EnGen Spy Cas9 NLS from NEB, Catalog # M0646M). The distribution of the major trichome height for the white control was normal (Shapiro-Wilk normality test W = 0.9637 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins (except from cells expressing eGFP and cytoplasmically tagged EGFR) were further treated with 250 U of PNGase F (NEB, Cat# P0704) for 1 hour at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... Electrophoresis was conducted in MES buffer at 100-120 V for 40 min with protein standards (NEB, P7119S, or Bio-Rad, #1610373). Proteins were transferred to nitrocellulose membrane and membranes blocked in 5% milk powder/PBS overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were incubated at 37°C and stopped for indicated time periods and the reaction was stopped by addition of 2 × RNA loading dye (New England Biolabs). For electrophoresis ...
-
bioRxiv - Genetics 2021Quote: ... input genomic DNA was amplified in a 20 μL reaction for 25 cycles using NEBNext High-Fidelity 2× PCR Master Mix (NEB). PCR products were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was buffer exchanged into enterokinase cleavage buffer (20 mM Tris pH 8, 50 mM NaCl, 2 mM CaCl2) and cleaved using bovine enterokinase (EK, NEB) at 16U/mg protein for 4 hrs ...
-
bioRxiv - Microbiology 2020Quote: ... This gBlocks fragment and a NdeI-HindIII-digested pET21b backbone were assembled together using a 2× Gibson master mix (NEB). Gibson assembly was possible due to a 23-bp sequence shared between the NdeI-HindIII-cut pET21b backbone and the gBlocks fragment ...
-
bioRxiv - Microbiology 2020Quote: ... Two and a half μL of each fragment at equimolar concentration was added to 5 μL 2× Gibson master mix (NEB), and the mixture was incubated at 50°C for 60 min ...