Labshake search
Citations for New England Biolabs :
2151 - 2200 of 2930 citations for Acyl protein thioesterase 2 LYPLA2 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Reactions were quenched by addition of EDTA to 50 mM and proteins were removed by treatment with proteinase K (20 units/ml) (NEB) and SDS (0.25% ...
-
bioRxiv - Molecular Biology 2024Quote: ... then 40 μL of each sample was used reactions as outlined in the manufacturer’s protocol for denaturing reaction conditions using the Protein Deglycosylation Mix II Kit (New England Biolabs, P6044) both with and without deglycosylase enzymes ...
-
bioRxiv - Molecular Biology 2024Quote: ... The pRL814 (containing green fluorescent protein (GFP) under control of PT7A1-O34) backbone was digested with NdeI and HindIII-HF (NEB). The digested backbone and amplified genes were ligated using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Biochemistry 2024Quote: PamB2-ribosome complexes were generated by in vitro transcription-translation reactions in PURExpress in vitro protein synthesis system (New England Biolabs) with the same reaction mix as described earlier in the toeprinting assays ...
-
bioRxiv - Plant Biology 2024Quote: ... MBP-RVE4 and MBP-RVE8 proteins were expressed in Escherichia coli BL21 strain according to the manufacturer’s instructions using the pMAL Protein Fusion and Purification System (New England Biolabs; #E8200) and purified using MBPtrap HP column (Cytiva ...
-
bioRxiv - Synthetic Biology 2024Quote: ... where separately introduced to the wild-type MS2 coat protein present in these mRNA constructs using the NEB-Q5 mutagenesis kit (New England Biolabs). The primer sets and PCR settings used are listed in supplementary information ...
-
bioRxiv - Microbiology 2024Quote: ... SINV-REP construct derived from pToto64 clone encoding SINV non-structural proteins and a reporter luciferase tag was linearized using SacI (New England Biolabs), followed by in vitro transcription using SP6 RNA polymerase (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 100 ng of unlabeled crRNA was mixed with equal volume of 2 × RNA loading dye (New England Biolabs) and fractionated in the 12% denaturing polyacrylamide gel ...
-
bioRxiv - Cell Biology 2019Quote: ... We incubated our cells in complete medium containing 2 μM of SNAP-Cell TMR-Star (New England Biolabs) during 20 min to label all pre-existing available SNAP-tag (Pulse) ...
-
bioRxiv - Cell Biology 2020Quote: ... MNase (non-specific DNA digestion) used MNase buffer and 2 μL of enzyme (20 units/μL) PvuII (NEB), AluI (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... The final libraries were purified on 2% preparative agarose gel by Monarch DNA Gel Extraction kit (NEB, T1020L). The concentration of each library was measured by performing quantitative PCR (qPCR ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were deglycosylated with PNGase F by adding 5μl of a solution consisting of 18μL of Glycobuffer 2 (10x) and 27μL of PNGaseF (NEB, P0708S). Endoproteinase Lys-C (Promega) ...
-
bioRxiv - Genomics 2020Quote: ... 1 mM ATP and 10 mM DTT and with 1 μl (2 U/μl) of RNase H (NEB), 1 μl (3 U/μl ...
-
bioRxiv - Molecular Biology 2020Quote: ... Methylated adapters (RRBS-1, RRBS-2; Table 1) were added by ligation using DNA ligase (New England Biolabs). DNA was purified using ratio of 1:1.2 sample to AMPure XP beads ...
-
bioRxiv - Genomics 2020Quote: ... After 2 rounds of SPRI cleanup the libraries were eluted in EB buffer and USER enzyme mix (NEB) was used to digest the second strand cDNA ...
-
bioRxiv - Genomics 2019Quote: ... We treated 2 µg debranched DNA using the UltraII end repair/dA-tailing enzyme mix (New England Biolabs) followed by a purification using a 0.6 volume ratio of AMPure beads ...
-
bioRxiv - Genomics 2019Quote: ... is manually added to each well using a multichannel pipette followed by 2 µL of lysis buffer (0.2 µL of 25 µg/µL Qiagen Protease, 0.2 µL of 10x NEB Buffer 4 and 1.6 µL of nuclease-free water ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 ng of PCR product of RFLP_region 1 and RFLP_region 2 were digested with PstI (New England Biolabs) and VspI (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2019Quote: 5μl of the first-strand reaction was mixed with 7.5μl of OneTaq HS Quick-load 2× (NEB, #M0486L) and 2.5μl water and amplified for three PCR cycles following the program ...
-
bioRxiv - Cancer Biology 2019Quote: ... 50 μL of NEB Buffer 2 and 15 μL of 25 U/μL MboI restriction enzyme (NEB, R0147) were then added ...
-
bioRxiv - Cell Biology 2019Quote: ... at 30°C for 1 hour in a total volume of 50μl PMP phosphatase buffer (50 mM HEPES pH 7.5, 100 mM NaCl, 2 mM DTT, 0.01% Brij 35, 1 mM MnCl2; New England Biolabs).
-
bioRxiv - Biochemistry 2019Quote: ... only the cells expressing iRFP-tau WT were treated with 2 U/μL λPP (New England Biolabs # P0753) for 3 hours at 30 °C with gentle rotating ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 2-3 μg of source DNA plasmid (<10 kb) was added with NEBuffer 3.1 (NEB, cat# B7203S), DEPC ddH2O in a volume of 30 μl and incubated at 37 °C for >2 hour (h) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 50 µL of NEB Buffer 2 and 15 µL of 25 U/µL MboI restriction enzyme (NEB, R0147) were then added ...
-
bioRxiv - Genomics 2021Quote: ... phage particles were lysed at 56 °C for 2 h in 550 μL of lysis buffer (100 mM Tris-HCl at pH 8.0, 27.3 mM EDTA, 2% SDS, ~1.6 U Proteinase K [NEB #P8107]). After lysis ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were incubated with 2 nM benzylguanine-Alexa Fluor 647 (New England Biolabs, SNAP-Surface Alexa Fluor 647) or custom synthesized SNAP substrate benzylguanine-DY549P1 for 30 min before an experiment ...
-
bioRxiv - Biochemistry 2020Quote: ... by incubating the cells with 2 μM ATTO594-Coenzyme A and 1 μM phosphopantetheine transferase (New England Biolabs) in Ham’s F12 medium without FBS at ~25°C for 20 min ...
-
bioRxiv - Plant Biology 2021Quote: ... transposed DNA was PCR amplified with 12 cycles using Next High-Fidelity 2×PCR Master Mix (NEB, M0541) with Nextera DNA CD Index primers ...
-
bioRxiv - Systems Biology 2020Quote: ... The purified transposed DNA was amplified with NEBNext High-Fidelity 2 X PCR Master Mix (New England Biolabs) and custom-designed primers with barcodes.30 Gel electrophoresis was used to remove primer dimers from the PCR products with 2% E-Gel EX Agarose Gels (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2021Quote: ... After digestion the plasmid vector and insert were added to Gibson assembly master mix (1.5 µl insert, 0.5 µl vector, 2 µl master mix) (New England BioLabs) and incubated at 50 °C for 1 hr ...
-
bioRxiv - Microbiology 2021Quote: ... and was then installed with 5’cap (Vaccinia Capping System, NEB, USA; Cap 2’-O-methyltransferase, NEB, USA) and 3’ Poly(A ...
-
bioRxiv - Microbiology 2020Quote: ... proteins were pre-treated with 0.5 mM ATP and 2.5 U casein kinase 2 (CK2) in 1X CK2 buffer (NEB) for 15 min at 30°C ...
-
bioRxiv - Immunology 2022Quote: T7 endonuclease I digestion: 200 ng of purified DNA amplicons were annealed with 1X NEBuffer 2 (NEB, # B7002S) and total volume was brought up to 19 uL ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μL of 2 mM dNTP and 0.5 μL (2.5 U) of DNA polymerase I Klenow fragment (New England Biolabs) were added to the reaction mixture ...
-
bioRxiv - Genetics 2022Quote: ... Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs; version 6.0 – 2/18) using NEBNext Multiplex Oligos for Illumina-Dual Index Primers Set 1 (#E7600S ...
-
bioRxiv - Immunology 2022Quote: ... Final amplification PCR was performed as described before by adding 8 µl of 2 x PCR MM (NEB) with number of cycles according to qPCR (usually Cq values were around 20) ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmids coding for segments 2 and 8 were digested using BbsI restriction enzyme (New England Biolab, NEB), the plasmid coding for segment 10 was linearized with BsaI (NEB) ...
-
bioRxiv - Bioengineering 2022Quote: ... and an additional hour after the addition of 2 U/ 50 µl of DNase (New England Biolabs, Inc.). The RNA samples were purified using an 8% Acrylamide:Bis-Acrylamide (29:1 ...
-
bioRxiv - Molecular Biology 2020Quote: Biotinylated DNA pellets were re suspended in 25μl TNE0.2 buffer (200mM NaCl, 10mMTris-HCl 7.5, 1mM EDTA) and mixed with 25μl Streptavidin coated magnetic beads (NEB, pre washed in TNE0.2 and blocked with 100μg/ml salmon sperm DNA) ...
-
bioRxiv - Neuroscience 2020Quote: ... A cDNA amplification mixture was prepared by adding 5µl of the resulting first strand cDNA with 7.5µl of OneTaq HS Quick-load 2× (NEB, #M0486L) and 2.5µl water ...
-
bioRxiv - Genomics 2020Quote: ... [2] Libraries prepared using the cf-RRBS protocol were cleaned by magnetic bead selection (AMPure XT beads – NEB) and eluted in 0.1X TE buffer ...
-
bioRxiv - Molecular Biology 2020Quote: Library preparation: TrAEL-seq adaptor 2 was added using a modified NEBNext Ultra II DNA kit (NEB E7645S): 3.5 μl NEBNext Ultra II End Prep buffer ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was generated from pCG1-SARS-2-S (a kind gift from M. Hoffmann9 by PCR (Phusion polymerase (NEB)) using primer pairs ...
-
bioRxiv - Molecular Biology 2020Quote: ... A 32P radiolabelled Y’ PCR fragment (oligo sequences in Supplementary Table 1) or 2-log ladder (NEB N3200L) was added at 106 counts/ml of Y’ and 104 counts/ml of 2-log ladder and hybridized overnight ...
-
bioRxiv - Microbiology 2022Quote: ... region between MCS-1/MCS-2 and linearized pETDuet plasmid were ligated using the Gibson Assembly® (NEB) to generate the pETDuet pe15/ppe20 plasmid ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Each sample was first treated with DNase I (New England Biolabs; 2 μL and 25μL of DNaseI buffer) for 1 h at 30 °C to remove any extracellular plasmid DNA ...
-
bioRxiv - Genetics 2022Quote: ... N is for a random nucleotide) were ligated to the small RNA by T4 RNA ligase 2 (NEB) and T4 ligase 1 (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and assembled into the backbone vector at a 2:1 molar ratio via Golden Gate Assembly81 (NEB #R3733). The assembly mix was then transformed into electrocompetent DH10B E ...